Author results

2KZD
  • Download 2kzd
  • View 2kzd
Molmil generated image of 2kzd
STRUCTURE OF A (3+1) G-QUADRUPLEX FORMED BY HTERT PROMOTER SEQUENCE
Descriptor:DNA (5'-D(*AP*GP*GP*GP*IP*AP*GP*GP*GP*GP*CP*TP*GP*GP*GP*AP*GP*GP*GP*C)-3')
Authors:Lim, K.W., Lacroix, L., Yue, D.J.E., Lim, J.K.C., Lim, J.M.W., Phan, A.T.
Deposit date:2010-06-16
Release date:2010-10-06
Last modified:2011-07-13
Method:SOLUTION NMR
Cite:Coexistence of two distinct G-quadruplex conformations in the hTERT promoter
J.Am.Chem.Soc., 132, 2010
2KZE
  • Download 2kze
  • View 2kze
Molmil generated image of 2kze
STRUCTURE OF AN ALL-PARALLEL-STRANDED G-QUADRUPLEX FORMED BY HTERT PROMOTER SEQUENCE
Descriptor:DNA (5'-D(*AP*IP*GP*GP*GP*AP*GP*GP*GP*IP*CP*TP*GP*GP*GP*AP*GP*GP*GP*C)-3')
Authors:Lim, K.W., Lacroix, L., Yue, D.J.E., Lim, J.K.C., Lim, J.M.W., Phan, A.T.
Deposit date:2010-06-16
Release date:2010-10-06
Last modified:2011-07-13
Method:SOLUTION NMR
Cite:Coexistence of two distinct G-quadruplex conformations in the hTERT promoter
J.Am.Chem.Soc., 132, 2010
2KF7
  • Download 2kf7
  • View 2kf7
Molmil generated image of 2kf7
STRUCTURE OF A TWO-G-TETRAD BASKET-TYPE INTRAMOLECULAR G-QUADRUPLEX FORMED BY HUMAN TELOMERIC REPEATS IN K+ SOLUTION (WITH G7-TO-BRG SUBSTITUTION)
Descriptor:HUMAN TELOMERE DNA
Authors:Lim, K.W., Amrane, S., Bouaziz, S., Xu, W., Mu, Y., Patel, D.J., Luu, K.N., Phan, A.T.
Deposit date:2009-02-12
Release date:2009-03-24
Last modified:2011-07-13
Method:SOLUTION NMR
Cite:Structure of the human telomere in K+ solution: a stable basket-type G-quadruplex with only two G-tetrad layers
J.Am.Chem.Soc., 131, 2009
2KF8
  • Download 2kf8
  • View 2kf8
Molmil generated image of 2kf8
STRUCTURE OF A TWO-G-TETRAD BASKET-TYPE INTRAMOLECULAR G-QUADRUPLEX FORMED BY HUMAN TELOMERIC REPEATS IN K+ SOLUTION
Descriptor:HUMAN TELOMERE DNA
Authors:Lim, K.W., Amrane, S., Bouaziz, S., Xu, W., Mu, Y., Patel, D.J., Luu, K.N., Phan, A.T.
Deposit date:2009-02-12
Release date:2009-03-24
Last modified:2011-07-13
Method:SOLUTION NMR
Cite:Structure of the human telomere in K+ solution: a stable basket-type G-quadruplex with only two G-tetrad layers
J.Am.Chem.Soc., 131, 2009
2KM3
  • Download 2km3
  • View 2km3
Molmil generated image of 2km3
STRUCTURE OF AN INTRAMOLECULAR G-QUADRUPLEX CONTAINING A G.C.G.C TETRAD FORMED BY HUMAN TELOMERIC VARIANT CTAGGG REPEATS
Descriptor:DNA (5'-D(*AP*GP*GP*GP*CP*TP*AP*GP*GP*GP*CP*TP*AP*GP*GP*GP*CP*TP*AP*GP*GP*G)-3')
Authors:Lim, K.W., Alberti, P., Guedin, A., Lacroix, L., Riou, J.F., Royle, N.J., Mergny, J.L., Phan, A.T.
Deposit date:2009-07-17
Release date:2009-11-03
Last modified:2011-07-13
Method:SOLUTION NMR
Cite:Sequence variant (CTAGGG)n in the human telomere favors a G-quadruplex structure containing a G.C.G.C tetrad
Nucleic Acids Res., 37, 2009
2M8Y
  • Download 2m8y
  • View 2m8y
Molmil generated image of 2m8y
STRUCTURE OF D[CGCGAAGCATTCGCG] HAIRPIN
Descriptor:DNA (5'-D(*CP*GP*CP*GP*AP*AP*GP*CP*AP*TP*TP*CP*GP*CP*G)-3')
Authors:Lim, K.W., Phan, A.T.
Deposit date:2013-05-30
Release date:2013-07-10
Method:SOLUTION NMR
Cite:Structural Basis of DNA Quadruplex-Duplex Junction Formation
Angew.Chem.Int.Ed.Engl., 2013
2M8Z
  • Download 2m8z
  • View 2m8z
Molmil generated image of 2m8z
STRUCTURE OF D[GGTTGGCGCGAAGCATTCGCGGGTTGG] QUADRUPLEX-DUPLEX HYBRID
Descriptor:27-MER DNA
Authors:Lim, K.W., Phan, A.T.
Deposit date:2013-05-30
Release date:2013-07-10
Method:SOLUTION NMR
Cite:Structural Basis of DNA Quadruplex-Duplex Junction Formation
Angew.Chem.Int.Ed.Engl., 2013
2M90
  • Download 2m90
  • View 2m90
Molmil generated image of 2m90
STRUCTURE OF D[GCGCGAAGCATTCGCGGGGAGGTGGGGAAGGG] QUADRUPLEX-DUPLEX HYBRID
Descriptor:32-MER DNA
Authors:Lim, K.W., Phan, A.T.
Deposit date:2013-05-30
Release date:2013-07-10
Method:SOLUTION NMR
Cite:Structural Basis of DNA Quadruplex-Duplex Junction Formation
Angew.Chem.Int.Ed.Engl., 2013
2M91
  • Download 2m91
  • View 2m91
Molmil generated image of 2m91
STRUCTURE OF D[GGGAAGGGCGCGAAGCATTCGCGAGGTAGG] QUADRUPLEX-DUPLEX HYBRID
Descriptor:30-MER DNA
Authors:Lim, K.W., Phan, A.T.
Deposit date:2013-05-30
Release date:2013-07-10
Method:SOLUTION NMR
Cite:Structural Basis of DNA Quadruplex-Duplex Junction Formation
Angew.Chem.Int.Ed.Engl., 2013
2M92
  • Download 2m92
  • View 2m92
Molmil generated image of 2m92
STRUCTURE OF D[AGGGTGGGTGCTGGGGCGCGAAGCATTCGCGAGG] QUADRUPLEX-DUPLEX HYBRID
Descriptor:34-MER DNA
Authors:Lim, K.W., Phan, A.T.
Deposit date:2013-05-30
Release date:2013-07-10
Method:SOLUTION NMR
Cite:Structural Basis of DNA Quadruplex-Duplex Junction Formation
Angew.Chem.Int.Ed.Engl., 2013
2M93
  • Download 2m93
  • View 2m93
Molmil generated image of 2m93
STRUCTURE OF D[TTGGGTGGGCGCGAAGCATTCGCGGGGTGGGT] QUADRUPLEX-DUPLEX HYBRID
Descriptor:32-MER DNA
Authors:Lim, K.W., Phan, A.T.
Deposit date:2013-05-30
Release date:2013-07-10
Method:SOLUTION NMR
Cite:Structural Basis of DNA Quadruplex-Duplex Junction Formation
Angew.Chem.Int.Ed.Engl., 2013
2MBJ
  • Download 2mbj
  • View 2mbj
Molmil generated image of 2mbj
STRUCTURE OF AN ANTIPARALLEL (2+2) G-QUADRUPLEX FORMED BY HUMAN TELOMERIC REPEATS IN NA+ SOLUTION (WITH G22-TO-BRG SUBSTITUTION)
Descriptor:DNA_(27-MER)
Authors:Lim, K.W., Ng, V.C.M., Martin-Pintado, N., Heddi, B., Phan, A.T.
Deposit date:2013-08-02
Release date:2013-09-18
Last modified:2014-01-08
Method:SOLUTION NMR
Cite:Structure of the human telomere in Na+ solution: an antiparallel (2+2) G-quadruplex scaffold reveals additional diversity.
Nucleic Acids Res., 41, 2013
2KOW
  • Download 2kow
  • View 2kow
Molmil generated image of 2kow
STRUCTURE OF A TWO-G-TETRAD BASKET-TYPE INTRAMOLECULAR G-QUADRUPLEX FORMED BY GIARDIA TELOMERIC REPEAT D(TAGGG)4 IN K+ SOLUTION (WITH G18-TO-INO SUBSTITUTION)
Descriptor:DNA (5'-D(*TP*AP*GP*GP*GP*TP*AP*GP*GP*GP*TP*AP*GP*GP*GP*TP*AP*IP*GP*G)-3')
Authors:Hu, L., Lim, K.W., Bouaziz, S., Phan, A.T.
Deposit date:2009-10-02
Release date:2009-11-17
Last modified:2011-07-13
Method:SOLUTION NMR
Cite:Giardia Telomeric Sequence d(TAGGG)(4) Forms Two Intramolecular G-Quadruplexes in K(+) Solution: Effect of Loop Length and Sequence on the Folding Topology.
J.Am.Chem.Soc., 131, 2009
2LE6
  • Download 2le6
  • View 2le6
Molmil generated image of 2le6
STRUCTURE OF A DIMERIC ALL-PARALLEL-STRANDED G-QUADRUPLEX STACKED VIA THE 5'-TO-5' INTERFACE
Descriptor:DNA (5'-D(*GP*IP*GP*TP*GP*GP*GP*TP*GP*GP*GP*TP*GP*GP*GP*T)-3')
Authors:Do, N.Q., Lim, K.W., Teo, M.H., Heddi, B., Phan, A.T.
Deposit date:2011-06-10
Release date:2011-08-31
Method:SOLUTION NMR
Cite:Stacking of G-quadruplexes: NMR structure of a G-rich oligonucleotide with potential anti-HIV and anticancer activity
Nucleic Acids Res., 2011
2MS9
  • Download 2ms9
  • View 2ms9
Molmil generated image of 2ms9
SOLUTION STRUCTURE OF A G-QUADRUPLEX
Descriptor:DNA (28-MER)
Authors:Chung, W.J., Heddi, B., Schmitt, E., Lim, K.W., Mechulam, Y., Phan, A.T.
Deposit date:2014-07-25
Release date:2015-02-18
Method:SOLUTION NMR
Cite:Structure of a left-handed DNA G-quadruplex
Proc.Natl.Acad.Sci.USA, 2015
4U5M
  • Download 4u5m
  • View 4u5m
Molmil generated image of 4u5m
STRUCTURE OF A LEFT-HANDED DNA G-QUADRUPLEX
Descriptor:DNA (28-MER), POTASSIUM ION, MAGNESIUM ION
Authors:Schmitt, E., Mechulam, Y., Phan, A.T., Brahim, H., Chung, W.J., Lim, K.W.
Deposit date:2014-07-25
Release date:2015-02-25
Last modified:2015-03-11
Method:X-RAY DIFFRACTION (1.5 Å)
Cite:Structure of a left-handed DNA G-quadruplex.
Proc.Natl.Acad.Sci.USA, 112, 2015