2M91
Structure of d[GGGAAGGGCGCGAAGCATTCGCGAGGTAGG] quadruplex-duplex hybrid
Summary for 2M91
| Entry DOI | 10.2210/pdb2m91/pdb |
| Related | 2M8Y 2M8Z 2M90 2M92 2M93 |
| NMR Information | BMRB: 19279 |
| Descriptor | 30-MER DNA (1 entity in total) |
| Functional Keywords | quadruplex-duplex hybrid, duplex, quadruplex, dna |
| Total number of polymer chains | 1 |
| Total formula weight | 9444.06 |
| Authors | Lim, K.W.,Phan, A.T. (deposition date: 2013-05-30, release date: 2013-07-10, Last modification date: 2024-05-15) |
| Primary citation | Lim, K.W.,Phan, A.T. Structural basis of DNA quadruplex-duplex junction formation. Angew.Chem.Int.Ed.Engl., 52:8566-8569, 2013 Cited by PubMed: 23794476DOI: 10.1002/anie.201302995 PDB entries with the same primary citation |
| Experimental method | SOLUTION NMR |
Structure validation
Download full validation report






