2M92
Structure of d[AGGGTGGGTGCTGGGGCGCGAAGCATTCGCGAGG] quadruplex-duplex hybrid
Summary for 2M92
Entry DOI | 10.2210/pdb2m92/pdb |
Related | 2M8Y 2M8Z 2M90 2M91 2M93 |
NMR Information | BMRB: 19280 |
Descriptor | 34-MER DNA (1 entity in total) |
Functional Keywords | quadruplex-duplex hybrid, duplex, quadruplex, dna |
Total number of polymer chains | 1 |
Total formula weight | 10702.83 |
Authors | Lim, K.W.,Phan, A.T. (deposition date: 2013-05-30, release date: 2013-07-10, Last modification date: 2023-06-14) |
Primary citation | Lim, K.W.,Phan, A.T. Structural basis of DNA quadruplex-duplex junction formation. Angew.Chem.Int.Ed.Engl., 52:8566-8569, 2013 Cited by PubMed: 23794476DOI: 10.1002/anie.201302995 PDB entries with the same primary citation |
Experimental method | SOLUTION NMR |
Structure validation
Download full validation report