2M92
Structure of d[AGGGTGGGTGCTGGGGCGCGAAGCATTCGCGAGG] quadruplex-duplex hybrid
Entity
| Entity ID | Chain ID | Description | Type | Chain length | Formula weight | Number of molecules | DB Name (Accession) | Biological source | Descriptive keywords |
| 1 | A (A) | 34-MER DNA | polymer | 34 | 10702.8 | 1 |
Sequence viewer
Contents of the asymmetric unit
| Polymers | Number of chains | 1 |
| Total formula weight | 10702.8 | |
| All* | Total formula weight | 10702.8 |






