5DZR
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 5dzr by Molmil](/molmil-images/mine/5dzr) | |
2FOW
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 2fow by Molmil](/molmil-images/mine/2fow) | THE RNA BINDING DOMAIN OF RIBOSOMAL PROTEIN L11: THREE-DIMENSIONAL STRUCTURE OF THE RNA-BOUND FORM OF THE PROTEIN, NMR, 26 STRUCTURES | Descriptor: | RIBOSOMAL PROTEIN L11 | Authors: | Hinck, A.P, Markus, M.A, Huang, S, Grzesiek, S, Kustanovich, I, Draper, D.E, Torchia, D.A. | Deposit date: | 1997-05-26 | Release date: | 1997-11-26 | Last modified: | 2024-05-29 | Method: | SOLUTION NMR | Cite: | The RNA binding domain of ribosomal protein L11: three-dimensional structure of the RNA-bound form of the protein and its interaction with 23 S rRNA. J.Mol.Biol., 274, 1997
|
|
1MUV
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 1muv by Molmil](/molmil-images/mine/1muv) | Sheared A(anti)-A(anti) Base Pairs in a Destabilizing 2x2 Internal Loop: The NMR Structure of 5'(rGGCAAGCCU)2 | Descriptor: | 5'-R(*GP*GP*CP*AP*AP*GP*CP*CP*U)-3' | Authors: | Znosko, B.M, Burkard, M.E, Schroeder, S.J, Krugh, T.R, Turner, D.H. | Deposit date: | 2002-09-24 | Release date: | 2002-12-18 | Last modified: | 2024-05-22 | Method: | SOLUTION NMR | Cite: | Sheared Aanti-Aanti Base Pairs in a Destabilizing 2x2 Internal Loop: The NMR Structure of
5'(rGGCAAGCCU)2 Biochemistry, 41, 2002
|
|
3N6N
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 3n6n by Molmil](/molmil-images/mine/3n6n) | crystal structure of EV71 RdRp in complex with Br-UTP | Descriptor: | 5-bromouridine 5'-(tetrahydrogen triphosphate), NICKEL (II) ION, RNA-dependent RNA polymerase | Authors: | Wu, Y, Lou, Z.Y, Miao, Y, Yu, Y, Rao, Z.H. | Deposit date: | 2010-05-26 | Release date: | 2011-06-15 | Last modified: | 2023-11-01 | Method: | X-RAY DIFFRACTION (2.9 Å) | Cite: | Structures of EV71 RNA-dependent RNA polymerase in complex with substrate and analogue provide a drug target against the hand-foot-and-mouth disease pandemic in China. Protein Cell, 1, 2010
|
|
3BSX
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 3bsx by Molmil](/molmil-images/mine/3bsx) | Crystal Structure of Human Pumilio 1 in complex with Puf5 RNA | Descriptor: | 5'-R(*UP*UP*GP*UP*AP*AP*UP*AP*UP*UP*A)-3', Pumilio homolog 1 | Authors: | Gupta, Y.K, Nair, D.T, Wharton, R.P, Aggarwal, A.K. | Deposit date: | 2007-12-26 | Release date: | 2008-04-08 | Last modified: | 2023-11-01 | Method: | X-RAY DIFFRACTION (2.32 Å) | Cite: | Structures of human Pumilio with noncognate RNAs reveal molecular mechanisms for binding promiscuity. Structure, 16, 2008
|
|
2D1P
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 2d1p by Molmil](/molmil-images/mine/2d1p) | crystal structure of heterohexameric TusBCD proteins, which are crucial for the tRNA modification | Descriptor: | Hypothetical UPF0116 protein yheM, Hypothetical UPF0163 protein yheN, Hypothetical protein yheL, ... | Authors: | Numata, T, Fukai, S, Ikeuchi, Y, Suzuki, T, Nureki, O. | Deposit date: | 2005-08-30 | Release date: | 2006-02-28 | Last modified: | 2024-03-13 | Method: | X-RAY DIFFRACTION (2.15 Å) | Cite: | Structural Basis for Sulfur Relay to RNA Mediated by Heterohexameric TusBCD Complex Structure, 14, 2006
|
|
6QI4
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 6qi4 by Molmil](/molmil-images/mine/6qi4) | NCS-1 bound to a ligand | Descriptor: | 2-(1~{H}-indol-3-yl)-~{N}-[(~{E})-(4-nitro-3-oxidanyl-phenyl)methylideneamino]ethanamide, ACETATE ION, CALCIUM ION, ... | Authors: | Sanchez-Barrena, M.J, Blanco-Gabella, P. | Deposit date: | 2019-01-17 | Release date: | 2019-07-17 | Last modified: | 2024-01-24 | Method: | X-RAY DIFFRACTION (1.78 Å) | Cite: | Insights into real-time chemical processes in a calcium sensor protein-directed dynamic library. Nat Commun, 10, 2019
|
|
7MLX
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 7mlx by Molmil](/molmil-images/mine/7mlx) | |
3Q0A
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 3q0a by Molmil](/molmil-images/mine/3q0a) | |
2JLU
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 2jlu by Molmil](/molmil-images/mine/2jlu) | Dengue virus 4 NS3 helicase in complex with ssRNA | Descriptor: | 5'-R(*AP*GP*AP*CP*UP*AP*AP*CP*AP*AP*CP*U)-3', GLYCEROL, SERINE PROTEASE SUBUNIT NS3 | Authors: | Luo, D.H, Xu, T, Watson, R.P, Becker, D.S, Sampath, A, Jahnke, W, Yeong, S.S, Wang, C.H, Lim, S.P, Vasudevan, S.G, Lescar, J. | Deposit date: | 2008-09-15 | Release date: | 2008-11-25 | Last modified: | 2023-12-13 | Method: | X-RAY DIFFRACTION (2.04 Å) | Cite: | Insights Into RNA Unwinding and ATP Hydrolysis by the Flavivirus Ns3 Protein. Embo J., 27, 2008
|
|
4QU7
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 4qu7 by Molmil](/molmil-images/mine/4qu7) | |
2JLX
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 2jlx by Molmil](/molmil-images/mine/2jlx) | Dengue virus 4 NS3 helicase in complex with ssRNA and ADP-Vanadate | Descriptor: | 5'-R(*AP*GP*AP*CP*UP*AP*AP*CP*AP*AP*CP*U)-3', ADENOSINE-5'-DIPHOSPHATE, CHLORIDE ION, ... | Authors: | Luo, D.H, Xu, T, Watson, R.P, Becker, D.S, Sampath, A, Jahnke, W, Yeong, S.S, Wang, C.H, Lim, S.P, Vasudevan, S.G, Lescar, J. | Deposit date: | 2008-09-15 | Release date: | 2008-11-25 | Last modified: | 2023-12-13 | Method: | X-RAY DIFFRACTION (2.2 Å) | Cite: | Insights Into RNA Unwinding and ATP Hydrolysis by the Flavivirus Ns3 Protein. Embo J., 27, 2008
|
|
2JLW
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 2jlw by Molmil](/molmil-images/mine/2jlw) | Dengue virus 4 NS3 helicase in complex with ssRNA2 | Descriptor: | 5'-R(*UP*AP*GP*AP*CP*UP*AP*AP*CP*AP*AP*CP*U)-3', GLYCEROL, PHOSPHATE ION, ... | Authors: | Luo, D.H, Xu, T, Watson, R.P, Becker, D.S, Sampath, A, Jahnke, W, Yeong, S.S, Wang, C.H, Lim, S.P, Vasudevan, S.G, Lescar, J. | Deposit date: | 2008-09-15 | Release date: | 2008-11-25 | Last modified: | 2023-12-13 | Method: | X-RAY DIFFRACTION (2.6 Å) | Cite: | Insights Into RNA Unwinding and ATP Hydrolysis by the Flavivirus Ns3 Protein Embo J., 27, 2008
|
|
2JLY
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 2jly by Molmil](/molmil-images/mine/2jly) | Dengue virus 4 NS3 helicase in complex with ssRNA and ADP-Phosphate | Descriptor: | 5'-R(*AP*GP*AP*CP*UP*AP*AP*CP*AP*AP*CP*U)-3', ADENOSINE-5'-DIPHOSPHATE, GLYCEROL, ... | Authors: | Luo, D.H, Xu, T, Watson, R.P, Becker, D.S, Sampath, A, Jahnke, W, Yeong, S.S, Wang, C.H, Lim, S.P, Vasudevan, S.G, Lescar, J. | Deposit date: | 2008-09-15 | Release date: | 2008-11-25 | Last modified: | 2023-12-13 | Method: | X-RAY DIFFRACTION (2.4 Å) | Cite: | Insights Into RNA Unwinding and ATP Hydrolysis by the Flavivirus Ns3 Protein. Embo J., 27, 2008
|
|
3O7X
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 3o7x by Molmil](/molmil-images/mine/3o7x) | |
2JLV
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 2jlv by Molmil](/molmil-images/mine/2jlv) | Dengue virus 4 NS3 helicase in complex with ssRNA and AMPPNP | Descriptor: | 5'-R(*AP*GP*AP*CP*UP*AP*AP*CP*AP*AP*CP*U)-3', CHLORIDE ION, GLYCEROL, ... | Authors: | Luo, D.H, Xu, T, Watson, R.P, Becker, D.S, Sampath, A, Jahnke, W, Yeong, S.S, Wang, C.H, Lim, S.P, Vasudevan, S.G, Lescar, J. | Deposit date: | 2008-09-15 | Release date: | 2008-11-25 | Last modified: | 2023-12-13 | Method: | X-RAY DIFFRACTION (1.9 Å) | Cite: | Insights Into RNA Unwinding and ATP Hydrolysis by the Flavivirus Ns3 Protein Embo J., 27, 2008
|
|
2JLZ
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 2jlz by Molmil](/molmil-images/mine/2jlz) | Dengue virus 4 NS3 helicase in complex with ssRNA and ADP | Descriptor: | 5'-R(*AP*GP*AP*CP*UP*AP*AP*CP*AP*AP*CP*U)-3', ADENOSINE-5'-DIPHOSPHATE, CHLORIDE ION, ... | Authors: | Luo, D.H, Xu, T, Watson, R.P, Becker, D.S, Sampath, A, Jahnke, W, Yeong, S.S, Wang, C.H, Lim, S.P, Vasudevan, S.G, Lescar, J. | Deposit date: | 2008-09-15 | Release date: | 2008-11-25 | Last modified: | 2023-12-13 | Method: | X-RAY DIFFRACTION (2.2 Å) | Cite: | Insights Into RNA Unwinding and ATP Hydrolysis by the Flavivirus Ns3 Protein. Embo J., 27, 2008
|
|
1NLC
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 1nlc by Molmil](/molmil-images/mine/1nlc) | HIV-1 DIS(Mal) duplex Zn-soaked | Descriptor: | HIV-1 DIS(MAL) genomic RNA, ZINC ION | Authors: | Ennifar, E, Walter, P, Dumas, P. | Deposit date: | 2003-01-07 | Release date: | 2003-05-13 | Last modified: | 2024-02-14 | Method: | X-RAY DIFFRACTION (1.85 Å) | Cite: | A crystallographic study of the binding of 13 metal ions to two related RNA duplexes. Nucleic Acids Res., 31, 2003
|
|
1FG0
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 1fg0 by Molmil](/molmil-images/mine/1fg0) | LARGE RIBOSOMAL SUBUNIT COMPLEXED WITH A 13 BP MINIHELIX-PUROMYCIN COMPOUND | Descriptor: | 23S RIBOSOMAL RNA, 5'-R(CCGGCGGGCUGGUUCAAACCGGCCCGCCGGACC)-3'-5'-R(P-PUROMYCIN)-3' | Authors: | Nissen, P, Hansen, J, Ban, N, Moore, P.B, Steitz, T.A. | Deposit date: | 2000-07-26 | Release date: | 2000-08-28 | Last modified: | 2024-02-07 | Method: | X-RAY DIFFRACTION (3 Å) | Cite: | The structural basis of ribosome activity in peptide bond synthesis. Science, 289, 2000
|
|
2AUK
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 2auk by Molmil](/molmil-images/mine/2auk) | Structure of E. coli RNA polymerase beta' G/G' insert | Descriptor: | DNA-directed RNA polymerase beta' chain | Authors: | Chlenov, M, Masuda, S, Murakami, K.S, Nikiforov, V, Darst, S.A, Mustaev, A. | Deposit date: | 2005-08-28 | Release date: | 2005-10-04 | Last modified: | 2024-02-14 | Method: | X-RAY DIFFRACTION (2.3 Å) | Cite: | Structure and Function of Lineage-specific Sequence Insertions in the Bacterial RNA Polymerase beta' Subunit J.Mol.Biol., 353, 2005
|
|
4KN4
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 4kn4 by Molmil](/molmil-images/mine/4kn4) | |
4KN7
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 4kn7 by Molmil](/molmil-images/mine/4kn7) | |
2AUJ
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 2auj by Molmil](/molmil-images/mine/2auj) | Structure of Thermus aquaticus RNA polymerase beta'-subunit insert | Descriptor: | DNA-directed RNA polymerase beta' chain | Authors: | Chlenov, M, Masuda, S, Murakami, K.S, Nikiforov, V, Darst, S.A, Mustaev, A. | Deposit date: | 2005-08-27 | Release date: | 2005-10-04 | Last modified: | 2024-02-14 | Method: | X-RAY DIFFRACTION (2.7 Å) | Cite: | Structure and Function of Lineage-specific Sequence Insertions in the Bacterial RNA Polymerase beta' Subunit J.Mol.Biol., 353, 2005
|
|
4KMU
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 4kmu by Molmil](/molmil-images/mine/4kmu) | |
4JGZ
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 4jgz by Molmil](/molmil-images/mine/4jgz) | Crystal structure of human coxsackievirus A16 uncoating intermediate (space group I222) | Descriptor: | Polyprotein, capsid protein VP1, capsid protein VP2, ... | Authors: | Ren, J, Wang, X, Hu, Z, Gao, Q, Sun, Y, Li, X, Porta, C, Walter, T.S, Gilbert, R.J, Zhao, Y, Axford, D, Williams, M, McAuley, K, Rowlands, D.J, Yin, W, Wang, J, Stuart, D.I, Rao, Z, Fry, E.E. | Deposit date: | 2013-03-04 | Release date: | 2013-06-05 | Last modified: | 2023-09-20 | Method: | X-RAY DIFFRACTION (3 Å) | Cite: | Picornavirus uncoating intermediate captured in atomic detail. Nat Commun, 4, 2013
|
|