7ZGO
| Cryo-EM structure of human NKCC1 (TM domain) | Descriptor: | (2S)-3-(hexadecanoyloxy)-2-[(9Z)-octadec-9-enoyloxy]propyl 2-(trimethylammonio)ethyl phosphate, CHLORIDE ION, CHOLESTEROL HEMISUCCINATE, ... | Authors: | Nissen, P, Fenton, R, Neumann, C, Lindtoft Rosenbaek, L, Kock Flygaard, R, Habeck, M, Lykkegaard Karlsen, J, Wang, Y, Lindorff-Larsen, K, Gad, H, Hartmann, R, Lyons, J. | Deposit date: | 2022-04-04 | Release date: | 2022-10-05 | Last modified: | 2023-04-19 | Method: | ELECTRON MICROSCOPY (2.55 Å) | Cite: | Cryo-EM structure of the human NKCC1 transporter reveals mechanisms of ion coupling and specificity. Embo J., 41, 2022
|
|
1B23
| E. coli cysteinyl-tRNA and T. aquaticus elongation factor EF-TU:GTP ternary complex | Descriptor: | CYSTEINE, CYSTEINYL TRNA, ELONGATION FACTOR TU, ... | Authors: | Nissen, P, Kjeldgaard, M, Thirup, S, Nyborg, J. | Deposit date: | 1998-12-04 | Release date: | 1998-12-07 | Last modified: | 2023-08-09 | Method: | X-RAY DIFFRACTION (2.6 Å) | Cite: | The crystal structure of Cys-tRNACys-EF-Tu-GDPNP reveals general and specific features in the ternary complex and in tRNA. Structure Fold.Des., 7, 1999
|
|
1TTT
| Phe-tRNA, elongation factoR EF-TU:GDPNP ternary complex | Descriptor: | MAGNESIUM ION, OF ELONGATION FACTOR TU (EF-TU), PHENYLALANINE, ... | Authors: | Nissen, P, Kjeldgaard, M, Thirup, S, Polekhina, G, Reshetnikova, L, Clark, B.F.C, Nyborg, J. | Deposit date: | 1995-11-16 | Release date: | 1996-12-23 | Last modified: | 2024-02-14 | Method: | X-RAY DIFFRACTION (2.7 Å) | Cite: | Crystal structure of the ternary complex of Phe-tRNAPhe, EF-Tu, and a GTP analog. Science, 270, 1995
|
|
1FG0
| LARGE RIBOSOMAL SUBUNIT COMPLEXED WITH A 13 BP MINIHELIX-PUROMYCIN COMPOUND | Descriptor: | 23S RIBOSOMAL RNA, 5'-R(CCGGCGGGCUGGUUCAAACCGGCCCGCCGGACC)-3'-5'-R(P-PUROMYCIN)-3' | Authors: | Nissen, P, Hansen, J, Ban, N, Moore, P.B, Steitz, T.A. | Deposit date: | 2000-07-26 | Release date: | 2000-08-28 | Last modified: | 2024-02-07 | Method: | X-RAY DIFFRACTION (3 Å) | Cite: | The structural basis of ribosome activity in peptide bond synthesis. Science, 289, 2000
|
|
1FFZ
| LARGE RIBOSOMAL SUBUNIT COMPLEXED WITH R(CC)-DA-PUROMYCIN | Descriptor: | 23S RIBOSOMAL RNA, R(P*CP*C*)-D(P*A)-R(P*(PU)) | Authors: | Nissen, P, Hansen, J, Ban, N, Moore, P.B, Steitz, T.A. | Deposit date: | 2000-07-26 | Release date: | 2000-08-28 | Last modified: | 2024-02-07 | Method: | X-RAY DIFFRACTION (3.2 Å) | Cite: | The structural basis of ribosome activity in peptide bond synthesis. Science, 289, 2000
|
|
3DWU
| |
4UMW
| CRYSTAL STRUCTURE OF A ZINC-TRANSPORTING PIB-TYPE ATPASE IN E2.PI STATE | Descriptor: | MAGNESIUM ION, TETRAFLUOROALUMINATE ION, ZINC-TRANSPORTING ATPASE | Authors: | Wang, K.T, Sitsel, O, Meloni, G, Autzen, H.E, Andersson, M, Klymchuk, T, Nielsen, A.M, Rees, D.C, Nissen, P, Gourdon, P. | Deposit date: | 2014-05-21 | Release date: | 2014-08-13 | Last modified: | 2024-01-10 | Method: | X-RAY DIFFRACTION (2.705 Å) | Cite: | Structure and Mechanism of Zn(2+)-Transporting P-Type Atpases. Nature, 514, 2014
|
|
3KDP
| Crystal structure of the sodium-potassium pump | Descriptor: | CHOLESTEROL, MAGNESIUM ION, Na+/K+ ATPase gamma subunit transcript variant a, ... | Authors: | Morth, J.P, Pedersen, B.P, Nissen, P. | Deposit date: | 2009-10-23 | Release date: | 2010-02-16 | Last modified: | 2017-11-01 | Method: | X-RAY DIFFRACTION (3.5 Å) | Cite: | Crystal structure of the sodium-potassium pump. Nature, 450, 2007
|
|
4US3
| Crystal Structure of the bacterial NSS member MhsT in an Occluded Inward-Facing State | Descriptor: | DODECYL-ALPHA-D-MALTOSIDE, SODIUM ION, TRANSPORTER, ... | Authors: | Malinauskaite, L, Quick, M, Reinhard, L, Lyons, J.A, Yano, H, Javitch, J.A, Nissen, P. | Deposit date: | 2014-07-02 | Release date: | 2014-09-24 | Last modified: | 2024-01-10 | Method: | X-RAY DIFFRACTION (2.098 Å) | Cite: | A Mechanism for Intracellular Release of Na+ by Neurotransmitter/Sodium Symporters Nat.Struct.Mol.Biol., 21, 2014
|
|
4XE5
| Crystal structure of the Na,K-ATPase from bovine | Descriptor: | CHOLESTEROL, MAGNESIUM ION, OUABAIN, ... | Authors: | Gregersen, J.L, Mattle, D, Fedosova, N.U, Nissen, P, Reinhard, L. | Deposit date: | 2014-12-22 | Release date: | 2016-03-09 | Last modified: | 2024-01-10 | Method: | X-RAY DIFFRACTION (3.901 Å) | Cite: | Isolation, crystallization and crystal structure determination of bovine kidney Na(+),K(+)-ATPase. Acta Crystallogr.,Sect.F, 72, 2016
|
|
3RFU
| Crystal structure of a copper-transporting PIB-type ATPase | Descriptor: | Copper efflux ATPase, MAGNESIUM ION, POTASSIUM ION, ... | Authors: | Gourdon, P, Liu, X, Skjorringe, T, Morth, J.P, Birk Moller, L, Panyella Pedersen, B, Nissen, P. | Deposit date: | 2011-04-07 | Release date: | 2011-06-29 | Last modified: | 2024-02-21 | Method: | X-RAY DIFFRACTION (3.2 Å) | Cite: | Crystal structure of a copper-transporting PIB-type ATPase. Nature, 475, 2011
|
|
5MPM
| SERCA2a from pig heart | Descriptor: | (6AR,11AS,11BR)-10-ACETYL-9-HYDROXY-7,7-DIMETHYL-2,6,6A,7,11A,11B-HEXAHYDRO-11H-PYRROLO[1',2':2,3]ISOINDOLO[4,5,6-CD]INDOL-11-ONE, MAGNESIUM ION, POTASSIUM ION, ... | Authors: | Drachmann, N.D, Sitsel, A, Andersen, J.L, Nissen, P, Olesen, C. | Deposit date: | 2016-12-16 | Release date: | 2018-01-17 | Last modified: | 2024-01-17 | Method: | X-RAY DIFFRACTION (3.3 Å) | Cite: | Structures of the heart specific SERCA2a Ca2+-ATPase. Embo J., 38, 2019
|
|
7OH6
| Cryo-EM structure of Drs2p-Cdc50p in the [PS]E2-AlFx state | Descriptor: | (2R)-1-{[(R)-hydroxy{[(1R,2R,3R,4R,5S,6R)-2,3,5,6-tetrahydroxy-4-(phosphonooxy)cyclohexyl]oxy}phosphoryl]oxy}-3-(octadecanoyloxy)propan-2-yl (5Z,8Z,11Z,14Z)-icosa-5,8,11,14-tetraenoate, 2-acetamido-2-deoxy-beta-D-glucopyranose, 2-acetamido-2-deoxy-beta-D-glucopyranose-(1-4)-2-acetamido-2-deoxy-beta-D-glucopyranose, ... | Authors: | Timcenko, M, Dieudonne, T, Montigny, C, Boesen, T, Lyons, J.A, Lenoir, G, Nissen, P. | Deposit date: | 2021-05-09 | Release date: | 2021-06-09 | Method: | ELECTRON MICROSCOPY (3 Å) | Cite: | Structural basis of substrate-independent phosphorylation in a P4-ATPase lipid flippase J.Mol.Biol., 2021
|
|
4LBY
| Identifying ligand binding hot spots in proteins using brominated fragments | Descriptor: | AMMONIUM ION, Elongation factor Tu-A, MAGNESIUM ION, ... | Authors: | Groftehauge, M.K, Therkelsen, M, Taaning, R, Skrydstrup, T, Morth, J.P, Nissen, P. | Deposit date: | 2013-06-21 | Release date: | 2013-09-11 | Last modified: | 2023-09-20 | Method: | X-RAY DIFFRACTION (2.692 Å) | Cite: | Identifying ligand-binding hot spots in proteins using brominated fragments. Acta Crystallogr.,Sect.F, 69, 2013
|
|
7OH4
| Cryo-EM structure of Drs2p-Cdc50p in the E1 state with PI4P and Mg2+ bound | Descriptor: | (2R)-1-{[(R)-hydroxy{[(1R,2R,3R,4R,5S,6R)-2,3,5,6-tetrahydroxy-4-(phosphonooxy)cyclohexyl]oxy}phosphoryl]oxy}-3-(octadecanoyloxy)propan-2-yl (5Z,8Z,11Z,14Z)-icosa-5,8,11,14-tetraenoate, 2-acetamido-2-deoxy-beta-D-glucopyranose, 2-acetamido-2-deoxy-beta-D-glucopyranose-(1-4)-2-acetamido-2-deoxy-beta-D-glucopyranose, ... | Authors: | Timcenko, M, Dieudonne, T, Montigny, C, Boesen, T, Lyons, J.A, Lenoir, G, Nissen, P. | Deposit date: | 2021-05-09 | Release date: | 2021-06-09 | Method: | ELECTRON MICROSCOPY (3 Å) | Cite: | Structural basis of substrate-independent phosphorylation in a P4-ATPase lipid flippase J.Mol.Biol., 2021
|
|
7OH7
| Cryo-EM structure of Drs2p-Cdc50p in the E1-AMPPCP state with PI4P bound | Descriptor: | (2R)-1-{[(R)-hydroxy{[(1R,2R,3R,4R,5S,6R)-2,3,5,6-tetrahydroxy-4-(phosphonooxy)cyclohexyl]oxy}phosphoryl]oxy}-3-(octadecanoyloxy)propan-2-yl (5Z,8Z,11Z,14Z)-icosa-5,8,11,14-tetraenoate, 2-acetamido-2-deoxy-beta-D-glucopyranose-(1-4)-2-acetamido-2-deoxy-beta-D-glucopyranose, Cell division control protein 50, ... | Authors: | Timcenko, M, Dieudonne, T, Montigny, C, Boesen, T, Lyons, J.A, Lenoir, G, Nissen, P. | Deposit date: | 2021-05-09 | Release date: | 2021-06-09 | Method: | ELECTRON MICROSCOPY (3.8 Å) | Cite: | Structural basis of substrate-independent phosphorylation in a P4-ATPase lipid flippase J.Mol.Biol., 2021
|
|
7OH5
| Cryo-EM structure of Drs2p-Cdc50p in the E1-AlFx-ADP state | Descriptor: | (2R)-1-{[(R)-hydroxy{[(1R,2R,3R,4R,5S,6R)-2,3,5,6-tetrahydroxy-4-(phosphonooxy)cyclohexyl]oxy}phosphoryl]oxy}-3-(octadecanoyloxy)propan-2-yl (5Z,8Z,11Z,14Z)-icosa-5,8,11,14-tetraenoate, 2-acetamido-2-deoxy-beta-D-glucopyranose, 2-acetamido-2-deoxy-beta-D-glucopyranose-(1-4)-2-acetamido-2-deoxy-beta-D-glucopyranose, ... | Authors: | Timcenko, M, Dieudonne, T, Montigny, C, Boesen, T, Lyons, J.A, Lenoir, G, Nissen, P. | Deposit date: | 2021-05-09 | Release date: | 2021-06-09 | Method: | ELECTRON MICROSCOPY (2.9 Å) | Cite: | Structural basis of substrate-independent phosphorylation in a P4-ATPase lipid flippase J.Mol.Biol., 2021
|
|
4UU0
| CRYSTAL STRUCTURE OF (SR) CALCIUM-ATPASE E2(TG) IN THE PRESENCE OF 14:1 PC | Descriptor: | GLYCEROL, MAGNESIUM ION, OCTANOIC ACID [3S-[3ALPHA, ... | Authors: | Drachmann, N.D, Olesen, C, Moeller, J.V, Guo, Z, Nissen, P, Bublitz, M. | Deposit date: | 2014-07-24 | Release date: | 2014-10-01 | Last modified: | 2024-01-10 | Method: | X-RAY DIFFRACTION (2.5 Å) | Cite: | Comparing Crystal Structures of Ca(2+) -ATPase in the Presence of Different Lipids. FEBS J., 281, 2014
|
|
1QZC
| Coordinates of S12, SH44, LH69 and SRL separately fitted into the cryo-EM map of EF-Tu ternary complex (GDP.Kirromycin) bound 70S ribosome | Descriptor: | 16S rRNA, 23S rRNA, 30S ribosomal protein S12 | Authors: | Valle, M, Zavialov, A, Li, W, Stagg, S.M, Sengupta, J, Nielsen, R.C, Nissen, P, Harvey, S.C, Ehrenberg, M, Frank, J. | Deposit date: | 2003-09-16 | Release date: | 2003-11-04 | Last modified: | 2024-02-14 | Method: | ELECTRON MICROSCOPY (9 Å) | Cite: | Incorporation of Aminoacyl-tRNA into the Ribosome as seen by Cryo-electron Microscopy Nat.Struct.Biol., 10, 2003
|
|
1QZB
| Coordinates of the A-site tRNA model fitted into the cryo-EM map of 70S ribosome in the pre-translocational state | Descriptor: | Phe-tRNA | Authors: | Valle, M, Zavialov, A, Li, W, Stagg, S.M, Sengupta, J, Nielsen, R.C, Nissen, P, Harvey, S.C, Ehrenberg, M, Frank, J. | Deposit date: | 2003-09-16 | Release date: | 2003-11-04 | Last modified: | 2024-02-14 | Method: | ELECTRON MICROSCOPY (9 Å) | Cite: | Incorporation of Aminoacyl-tRNA into the Ribosome as seen by Cryo-electron Microscopy Nat.Struct.Biol., 10, 2003
|
|
1QZA
| Coordinates of the A/T site tRNA model fitted into the cryo-EM map of EF-Tu ternary complex (GDP.Kirromycin) bound 70S ribosome | Descriptor: | Phe-tRNA | Authors: | Valle, M, Zavialov, A, Li, W, Stagg, S.M, Sengupta, J, Nielsen, R.C, Nissen, P, Harvey, S.C, Ehrenberg, M, Frank, J. | Deposit date: | 2003-09-16 | Release date: | 2003-11-04 | Last modified: | 2024-02-14 | Method: | ELECTRON MICROSCOPY (10 Å) | Cite: | Incorporation of Aminoacyl-tRNA into the Ribosome as seen by Cryo-electron Microscopy Nat.Struct.Biol., 10, 2003
|
|
6XWM
| Mechanism of substrate release in neurotransmitter:sodium symporters: the structure of LeuT in an inward-facing occluded conformation | Descriptor: | Na(+):neurotransmitter symporter (Snf family), PHENYLALANINE, SODIUM ION | Authors: | Boesen, T, Nissen, P, Gotfryd, K, Loland, C.J, Gether, U. | Deposit date: | 2020-01-24 | Release date: | 2020-05-06 | Last modified: | 2024-01-24 | Method: | X-RAY DIFFRACTION (2.6 Å) | Cite: | X-ray structure of LeuT in an inward-facing occluded conformation reveals mechanism of substrate release. Nat Commun, 11, 2020
|
|
5I32
| Ammonia permeable aquaporin AtTIP2;1 | Descriptor: | Aquaporin TIP2-1 | Authors: | Kirscht, A, Nissen, P, Kjellbom, P, Gourdon, P, Johanson, U. | Deposit date: | 2016-02-09 | Release date: | 2016-04-06 | Last modified: | 2024-01-10 | Method: | X-RAY DIFFRACTION (1.18 Å) | Cite: | Crystal Structure of an Ammonia-Permeable Aquaporin. Plos Biol., 14, 2016
|
|
1QZD
| EF-Tu.kirromycin coordinates fitted into the cryo-EM map of EF-Tu ternary complex (GDP.Kirromycin) bound 70S ribosome | Descriptor: | Elongation factor Tu | Authors: | Valle, M, Zavialov, A, Li, W, Stagg, S.M, Sengupta, J, Nielsen, R.C, Nissen, P, Harvey, S.C, Ehrenberg, M, Frank, J. | Deposit date: | 2003-09-16 | Release date: | 2003-11-04 | Last modified: | 2024-02-14 | Method: | ELECTRON MICROSCOPY (10 Å) | Cite: | Incorporation of Aminoacyl-tRNA into the Ribosome as seen by Cryo-electron Microscopy Nat.Struct.Biol., 10, 2003
|
|
4US7
| Sulfur SAD Phased Structure of a Type IV Pilus Protein from Shewanella oneidensis | Descriptor: | PILD PROCESSED PROTEIN, SODIUM ION, SULFATE ION | Authors: | Gorgel, M, Boeggild, A, Ulstrup, J.J, Mueller, U, Weiss, M, Nissen, P, Boesen, T. | Deposit date: | 2014-07-03 | Release date: | 2015-04-29 | Method: | X-RAY DIFFRACTION (1.96 Å) | Cite: | High-Resolution Structure of a Type Iv Pilin from the Metal- Reducing Bacterium Shewanella Oneidensis. Bmc Struct.Biol., 15, 2015
|
|