4D4B
 
 | | The catalytic domain, BcGH76, of Bacillus circulans Aman6 in complex with MSMSMe | | Descriptor: | 1,2-ETHANEDIOL, ALPHA-1,6-MANNANASE, alpha-D-mannopyranose-(1-6)-methyl 1,6-dithio-alpha-D-mannopyranoside | | Authors: | Thompson, A.J, Speciale, G, Iglesias-Fernandez, J, Hakki, Z, Belz, T, Cartmell, A, Spears, R.J, Stepper, J, Gilbert, H.J, Rovira, C, Williams, S.J, Davies, G.J. | | Deposit date: | 2014-10-27 | | Release date: | 2015-03-25 | | Last modified: | 2024-05-01 | | Method: | X-RAY DIFFRACTION (1.3 Å) | | Cite: | Evidence for a Boat Conformation at the Transition State of Gh76 Alpha-1,6-Mannanases- Key Enzymes in Bacterial and Fungal Mannoprotein Metabolism
Angew.Chem.Int.Ed.Engl., 54, 2015
|
|
4D4D
 | | The catalytic domain, BcGH76, of Bacillus circulans Aman6 in complex with 1,6-ManIFG | | Descriptor: | 1,2-ETHANEDIOL, 5-HYDROXYMETHYL-3,4-DIHYDROXYPIPERIDINE, ALPHA-1,6-MANNANASE, ... | | Authors: | Thompson, A.J, Speciale, G, Iglesias-Fernandez, J, Hakki, Z, Belz, T, Cartmell, A, Spears, R.J, Stepper, J, Gilbert, H.J, Rovira, C, Williams, S.J, Davies, G.J. | | Deposit date: | 2014-10-27 | | Release date: | 2015-03-25 | | Last modified: | 2024-05-01 | | Method: | X-RAY DIFFRACTION (1.4 Å) | | Cite: | Evidence for a Boat Conformation at the Transition State of Gh76 Alpha-1,6-Mannanases- Key Enzymes in Bacterial and Fungal Mannoprotein Metabolism
Angew.Chem.Int.Ed.Engl., 54, 2015
|
|
4D4C
 | | The catalytic domain, BcGH76, of Bacillus circulans Aman6 in complex with 1,6-ManDMJ | | Descriptor: | 1,2-ETHANEDIOL, 1-DEOXYMANNOJIRIMYCIN, ALPHA-1,6-MANNANASE, ... | | Authors: | Thompson, A.J, Speciale, G, Iglesias-Fernandez, J, Hakki, Z, Belz, T, Cartmell, A, Spears, R.J, Stepper, J, Gilbert, H.J, Rovira, C, Williams, S.J, Davies, G.J. | | Deposit date: | 2014-10-27 | | Release date: | 2015-03-25 | | Last modified: | 2024-05-01 | | Method: | X-RAY DIFFRACTION (1.3 Å) | | Cite: | Evidence for a Boat Conformation at the Transition State of Gh76 Alpha-1,6-Mannanases- Key Enzymes in Bacterial and Fungal Mannoprotein Metabolism
Angew.Chem.Int.Ed.Engl., 54, 2015
|
|
2KSS
 | | NMR structure of Myxococcus xanthus antirepressor CarS1 | | Descriptor: | Carotenogenesis protein carS | | Authors: | Jimenez, M, Gonzalez, C, Padmanabhan, S, Leon, E, Navarro-Aviles, G, Elias-Arnanz, M. | | Deposit date: | 2010-01-13 | | Release date: | 2010-05-12 | | Last modified: | 2024-05-01 | | Method: | SOLUTION NMR | | Cite: | A bacterial antirepressor with SH3 domain topology mimics operator DNA in sequestering the repressor DNA recognition helix.
Nucleic Acids Res., 38, 2010
|
|
2IWC
 | | Benzylpenicilloyl-acylated MecR1 extracellular antibiotic-sensor domain. | | Descriptor: | METHICILLIN RESISTANCE MECR1 PROTEIN, OPEN FORM - PENICILLIN G | | Authors: | Marrero, A, Mallorqui-Fernandez, G, Guevara, T, Garcia-Castellanos, R, Gomis-Ruth, F.X. | | Deposit date: | 2006-06-27 | | Release date: | 2006-07-04 | | Last modified: | 2023-12-13 | | Method: | X-RAY DIFFRACTION (2.1 Å) | | Cite: | Unbound and Acylated Structures of the Mecr1 Extracellular Antibiotic-Sensor Domain Provide Insights Into the Signal-Transduction System that Triggers Methicillin Resistance.
J.Mol.Biol., 361, 2006
|
|
2IWB
 | | MecR1 unbound extracellular antibiotic-sensor domain. | | Descriptor: | GLYCEROL, METHICILLIN RESISTANCE MECR1 PROTEIN, NICKEL (II) ION, ... | | Authors: | Marrero, A, Mallorqui-Fernandez, G, Guevara, T, Garcia-Castellanos, R, Gomis-Ruth, F.X. | | Deposit date: | 2006-06-27 | | Release date: | 2006-07-04 | | Last modified: | 2023-12-13 | | Method: | X-RAY DIFFRACTION (1.8 Å) | | Cite: | Unbound and Acylated Structures of the Mecr1 Extracellular Antibiotic-Sensor Domain Provide Insights Into the Signal-Transduction System that Triggers Methicillin Resistance.
J.Mol.Biol., 361, 2006
|
|
1SAX
 | | Three-dimensional structure of s.aureus methicillin-resistance regulating transcriptional repressor meci in complex with 25-bp ds-DNA | | Descriptor: | 5'-d(CAAAATTACAACTGTAATATCGGAG)-3', 5'-d(GCTCCGATATTACAGTTGTAATTTT)-3', Methicillin resistance regulatory protein mecI, ... | | Authors: | Garcia-Castellanos, R, Mallorqui-Fernandez, G, Marrero, A, Potempa, J, Coll, M, Gomis-Ruth, F.X. | | Deposit date: | 2004-02-09 | | Release date: | 2004-04-27 | | Last modified: | 2023-08-23 | | Method: | X-RAY DIFFRACTION (2.8 Å) | | Cite: | On the transcriptional regulation of methicillin resistance: MecI repressor in complex with its operator
J.Biol.Chem., 279, 2004
|
|
2JML
 | | Solution structure of the N-terminal domain of CarA repressor | | Descriptor: | DNA BINDING DOMAIN/TRANSCRIPTIONAL REGULATOR | | Authors: | Jimenez, M, Padmanabhan, S, Gonzalez, C, Perez-Marin, M.C, Elias-Arnanz, M, Murillo, F.J, Rico, M. | | Deposit date: | 2006-11-20 | | Release date: | 2007-02-13 | | Last modified: | 2023-12-20 | | Method: | SOLUTION NMR | | Cite: | Structural basis for operator and antirepressor recognition by Myxococcus xanthus CarA repressor.
Mol.Microbiol., 63, 2007
|
|
7V93
 | | Cryo-EM structure of the Cas12c2-sgRNA binary complex | | Descriptor: | cas12c2, sgRNA | | Authors: | Kurihara, N, Hirano, H, Tomita, A, Kobayashi, K, Kusakizako, T, Nishizawa, T, Yamashita, K, Nishimasu, H, Nureki, O. | | Deposit date: | 2021-08-24 | | Release date: | 2022-04-13 | | Last modified: | 2024-06-12 | | Method: | ELECTRON MICROSCOPY (3 Å) | | Cite: | Structure of the type V-C CRISPR-Cas effector enzyme.
Mol.Cell, 82, 2022
|
|
1YRG
 | | THE CRYSTAL STRUCTURE OF RNA1P: A NEW FOLD FOR A GTPASE-ACTIVATING PROTEIN | | Descriptor: | GTPASE-ACTIVATING PROTEIN RNA1_SCHPO | | Authors: | Hillig, R.C, Renault, L, Vetter, I.R, Drell, T, Wittinghofer, A, Becker, J. | | Deposit date: | 1999-03-29 | | Release date: | 2000-03-29 | | Last modified: | 2023-12-27 | | Method: | X-RAY DIFFRACTION (2.66 Å) | | Cite: | The crystal structure of rna1p: a new fold for a GTPase-activating protein.
Mol.Cell, 3, 1999
|
|
4U3P
 | | Octameric RNA duplex co-crystallized with strontium(II)chloride | | Descriptor: | RNA (5'-R(*UP*CP*GP*UP*AP*CP*GP*A)-3'), STRONTIUM ION | | Authors: | Schaffer, M.F, Spingler, B, Schnabl, J, Peng, G, Olieric, V, Sigel, R.K.O. | | Deposit date: | 2014-07-22 | | Release date: | 2015-07-29 | | Last modified: | 2023-12-20 | | Method: | X-RAY DIFFRACTION (1.866 Å) | | Cite: | The X-ray Structures of Six Octameric RNA Duplexes in the Presence of Different Di- and Trivalent Cations.
Int J Mol Sci, 17, 2016
|
|
4U47
 | | Octameric RNA duplex soaked in terbium(III)chloride | | Descriptor: | RNA (5'-R(*UP*CP*GP*UP*AP*CP*GP*A)-3'), TERBIUM(III) ION | | Authors: | Schaffer, M.F, Spingler, B, Schnabl, J, Peng, G, Olieric, V, Sigel, R.K.O. | | Deposit date: | 2014-07-23 | | Release date: | 2015-08-05 | | Last modified: | 2023-12-20 | | Method: | X-RAY DIFFRACTION (1.952 Å) | | Cite: | The X-ray Structures of Six Octameric RNA Duplexes in the Presence of Different Di- and Trivalent Cations.
Int J Mol Sci, 17, 2016
|
|
4WFZ
 | |
7NW0
 | | RNA polymerase II pre-initiation complex with open promoter DNA | | Descriptor: | ADENOSINE-5'-DIPHOSPHATE, BERYLLIUM TRIFLUORIDE ION, CDK-activating kinase assembly factor MAT1, ... | | Authors: | Aibara, S, Schilbach, S, Cramer, P. | | Deposit date: | 2021-03-16 | | Release date: | 2021-05-05 | | Last modified: | 2024-07-10 | | Method: | ELECTRON MICROSCOPY (6.6 Å) | | Cite: | Structures of mammalian RNA polymerase II pre-initiation complexes.
Nature, 594, 2021
|
|
7NVZ
 | | RNA polymerase II pre-initiation complex with closed promoter DNA in distal position | | Descriptor: | CDK-activating kinase assembly factor MAT1, DNA-directed RNA polymerase II subunit E, DNA-directed RNA polymerase II subunit F, ... | | Authors: | Aibara, S, Schilbach, S, Cramer, P. | | Deposit date: | 2021-03-16 | | Release date: | 2021-05-05 | | Last modified: | 2024-07-10 | | Method: | ELECTRON MICROSCOPY (7.2 Å) | | Cite: | Structures of mammalian RNA polymerase II pre-initiation complexes.
Nature, 594, 2021
|
|
7NVY
 | | RNA polymerase II pre-initiation complex with closed promoter DNA in proximal position | | Descriptor: | CDK-activating kinase assembly factor MAT1, DNA-directed RNA polymerase II subunit E, DNA-directed RNA polymerase II subunit F, ... | | Authors: | Aibara, S, Schilbach, S, Cramer, P. | | Deposit date: | 2021-03-16 | | Release date: | 2021-05-05 | | Last modified: | 2024-07-10 | | Method: | ELECTRON MICROSCOPY (7.3 Å) | | Cite: | Structures of mammalian RNA polymerase II pre-initiation complexes.
Nature, 594, 2021
|
|
8QQ2
 | |
8QW9
 | |
5K0Y
 | | m48S late-stage initiation complex, purified from rabbit reticulocytes lysates, displaying eIF2 ternary complex and eIF3 i and g subunits relocated to the intersubunit face | | Descriptor: | 18S ribosomal RNA, 40S ribosomal protein S12, 40S ribosomal protein S21, ... | | Authors: | Simonetti, A, Brito Querido, J, Myasnikov, A.G, Mancera-Martinez, E, Renaud, A, Kuhn, L, Hashem, Y. | | Deposit date: | 2016-05-17 | | Release date: | 2016-07-13 | | Last modified: | 2025-05-07 | | Method: | ELECTRON MICROSCOPY (5.8 Å) | | Cite: | eIF3 Peripheral Subunits Rearrangement after mRNA Binding and Start-Codon Recognition.
Mol.Cell, 63, 2016
|
|
2J7O
 | | STRUCTURE OF THE RNAI POLYMERASE FROM NEUROSPORA CRASSA | | Descriptor: | MAGNESIUM ION, RNA DEPENDENT RNA POLYMERASE | | Authors: | Salgado, P.S, Koivunen, M.R.L, Makeyev, E.V, Bamford, D.H, Stuart, D.I, Grimes, J.M. | | Deposit date: | 2006-10-13 | | Release date: | 2006-12-13 | | Last modified: | 2024-05-08 | | Method: | X-RAY DIFFRACTION (3.5 Å) | | Cite: | The Structure of an Rnai Polymerase Links RNA Silencing and Transcription.
Plos Biol., 4, 2006
|
|
6F5P
 | |
6F5O
 | |
6THD
 | | Multiple Genomic RNA-Coat Protein Contacts Play Vital Roles in the Assembly of Infectious Enterovirus-E | | Descriptor: | Genome polyprotein, MYRISTIC ACID, SULFATE ION | | Authors: | Chandler-Bostock, R, Mata, C.P, Bingham, R, Dykeman, E.J, Meng, B, Tuthill, T.J, Rowlands, D.J, Ranson, N.A, Twarock, R, Stockley, P.G. | | Deposit date: | 2019-11-19 | | Release date: | 2020-12-09 | | Last modified: | 2024-05-22 | | Method: | ELECTRON MICROSCOPY (2.23 Å) | | Cite: | Assembly of infectious enteroviruses depends on multiple, conserved genomic RNA-coat protein contacts.
Plos Pathog., 16, 2020
|
|
5DCA
 | | Crystal structure of yeast full length Brr2 in complex with Prp8 Jab1 domain | | Descriptor: | Pre-mRNA-splicing factor 8, Pre-mRNA-splicing helicase BRR2 | | Authors: | Absmeier, E, Wollenhaupt, J, Santos, K.F, Wahl, M.C. | | Deposit date: | 2015-08-23 | | Release date: | 2015-12-16 | | Last modified: | 2024-01-10 | | Method: | X-RAY DIFFRACTION (2.8 Å) | | Cite: | The large N-terminal region of the Brr2 RNA helicase guides productive spliceosome activation.
Genes Dev., 29, 2015
|
|
2VAL
 | | Crystal structure of an Escherichia coli tRNAGly microhelix at 2.0 Angstrom resolution | | Descriptor: | 5'-R(*GP*CP*GP*GP*GP*AP*AP)-3', 5'-R(*UP*UP*CP*CP*CP*GP*CP)-3', MAGNESIUM ION | | Authors: | Forster, C, Brauer, A.B.E, Perbandt, M, Lehmann, D, Furste, J.P, Betzel, C, Erdmann, V.A. | | Deposit date: | 2007-09-03 | | Release date: | 2007-10-16 | | Last modified: | 2024-05-08 | | Method: | X-RAY DIFFRACTION (2 Å) | | Cite: | Crystal Structure of an Escherichia Coli Trnagly Microhelix at 2.0 Angstrom Resolution
Biochem.Biophys.Res.Commun., 363, 2007
|
|
