Loading
PDBj
MenuPDBj@FacebookPDBj@X(formerly Twitter)PDBj@BlueSkyPDBj@YouTubewwPDB FoundationwwPDBDonate
RCSB PDBPDBeBMRBAdv. SearchSearch help

1SAX

Three-dimensional structure of s.aureus methicillin-resistance regulating transcriptional repressor meci in complex with 25-bp ds-DNA

Summary for 1SAX
Entry DOI10.2210/pdb1sax/pdb
Related1OKR
Descriptor5'-d(GCTCCGATATTACAGTTGTAATTTT)-3', 5'-d(CAAAATTACAACTGTAATATCGGAG)-3', Methicillin resistance regulatory protein mecI, ... (5 entities in total)
Functional Keywordswinged helix-turn-helix, transcription-dna complex, transcription/dna
Biological sourceStaphylococcus aureus subsp. aureus
Cellular locationCytoplasm (Probable): P68262
Total number of polymer chains4
Total formula weight45016.08
Authors
Garcia-Castellanos, R.,Mallorqui-Fernandez, G.,Marrero, A.,Potempa, J.,Coll, M.,Gomis-Ruth, F.X. (deposition date: 2004-02-09, release date: 2004-04-27, Last modification date: 2023-08-23)
Primary citationGarcia-Castellanos, R.,Mallorqui-Fernandez, G.,Marrero, A.,Potempa, J.,Coll, M.,Gomis-Ruth, F.X.
On the transcriptional regulation of methicillin resistance: MecI repressor in complex with its operator
J.Biol.Chem., 279:17888-17896, 2004
Cited by
PubMed Abstract: Bacterial resistance to antibiotics poses a serious worldwide public health problem due to the high morbidity and mortality caused by infectious diseases. Most hospital-onset infections are associated with methicillin-resistant Staphylococcus aureus (MRSA) strains that have acquired multiple drug resistance to beta-lactam antibiotics. In a response to antimicrobial stress, nearly all clinical MRSA isolates produce beta-lactamase (BlaZ) and a penicillin-binding protein with low affinity for beta-lactam antibiotics (PBP2a, also known as PBP2' or MecA). Both effectors are regulated by homologous signal transduction systems consisting of a sensor/transducer and a transcriptional repressor. MecI (methicillin repressor) blocks mecA but also blaZ transcription and that of itself and the co-transcribed sensor/transducer. The structure of MecI in complex with a cognate operator double-stranded DNA reveals a homodimeric arrangement with a novel C-terminal spiral staircase dimerization domain responsible for dimer integrity. Each protomer interacts with the DNA major groove through a winged helix DNA-binding domain and specifically recognizes the nucleotide sequence 5'-Gua-Thy-Ade-X-Thy-3'. This results in an unusual convex bending of the DNA helix. The structure of this first molecular determinant of methicillin resistance in complex with its target DNA provides insights into its regulatory mechanism and paves the way for new antimicrobial strategies against MRSA.
PubMed: 14960592
DOI: 10.1074/jbc.M313123200
PDB entries with the same primary citation
Experimental method
X-RAY DIFFRACTION (2.8 Å)
Structure validation

256789

PDB entries from 2026-07-22

PDB statisticsPDBj update infoContact PDBjnumon