1SAX
Three-dimensional structure of s.aureus methicillin-resistance regulating transcriptional repressor meci in complex with 25-bp ds-DNA
Entity
| Entity ID | Chain ID | Description | Type | Chain length | Formula weight | Number of molecules | DB Name (Accession) | Biological source | Descriptive keywords |
| 1 | A (C) | 5'-d(GCTCCGATATTACAGTTGTAATTTT)-3' | polymer | 25 | 7654.0 | 1 | |||
| 2 | B (D) | 5'-d(CAAAATTACAACTGTAATATCGGAG)-3' | polymer | 25 | 7699.0 | 1 | |||
| 3 | C, D (A, B) | Methicillin resistance regulatory protein mecI | polymer | 123 | 14812.0 | 2 | UniProt (P68262) Pfam (PF03965) UniProt (by SIFTS) (P68261) | Staphylococcus aureus subsp. aureus | Methicillin repressor MecI; mecI |
| 4 | E (B) | POTASSIUM ION | non-polymer | 39.1 | 1 | Chemie (K) | |||
| 5 | F, G, H, I (C, D, A, B) | water | water | 18.0 | 37 | Chemie (HOH) |
Sequence viewer
Contents of the asymmetric unit
| Polymers | Number of chains | 4 |
| Total formula weight | 44977.0 | |
| Non-Polymers* | Number of molecules | 1 |
| Total formula weight | 39.1 | |
| All* | Total formula weight | 45016.1 |
