1SAX
| Three-dimensional structure of s.aureus methicillin-resistance regulating transcriptional repressor meci in complex with 25-bp ds-DNA | Descriptor: | 5'-d(CAAAATTACAACTGTAATATCGGAG)-3', 5'-d(GCTCCGATATTACAGTTGTAATTTT)-3', Methicillin resistance regulatory protein mecI, ... | Authors: | Garcia-Castellanos, R, Mallorqui-Fernandez, G, Marrero, A, Potempa, J, Coll, M, Gomis-Ruth, F.X. | Deposit date: | 2004-02-09 | Release date: | 2004-04-27 | Last modified: | 2023-08-23 | Method: | X-RAY DIFFRACTION (2.8 Å) | Cite: | On the transcriptional regulation of methicillin resistance: MecI repressor in complex with its operator J.Biol.Chem., 279, 2004
|
|
2BOA
| Human procarboxypeptidase A4. | Descriptor: | 2-acetamido-2-deoxy-beta-D-glucopyranose, 2-acetamido-2-deoxy-beta-D-glucopyranose-(1-4)-2-acetamido-2-deoxy-beta-D-glucopyranose, CARBOXYPEPTIDASE A4, ... | Authors: | Garcia-Castellanos, R, Bonet-Figueredo, R, Pallares, I, Ventura, S, Aviles, F.X, Vendrell, J, Gomis-Ruth, F.X. | Deposit date: | 2005-04-08 | Release date: | 2005-12-13 | Last modified: | 2023-12-13 | Method: | X-RAY DIFFRACTION (2.2 Å) | Cite: | Detailed Molecular Comparison between the Inhibition Mode of A/B-Type Carboxypeptidases in the Zymogen State and by the Endogenous Inhibitor Latexin. Cell.Mol.Life Sci., 62, 2005
|
|
1OKR
| Three-dimensional structure of S.aureus methicillin-resistance regulating transcriptional repressor MecI. | Descriptor: | CHLORIDE ION, GLYCEROL, METHICILLIN RESISTANCE REGULATORY PROTEIN MECI | Authors: | Garcia-Castellanos, R, Marrero, A, Mallorqui-Fernandez, G, Potempa, J, Coll, M, Gomis-Ruth, F.X. | Deposit date: | 2003-07-28 | Release date: | 2003-10-09 | Last modified: | 2019-04-03 | Method: | X-RAY DIFFRACTION (2.4 Å) | Cite: | Three-Dimensional Structure of Meci: Molecular Basis for Transcriptional Regulation of Staphylococcal Methicillin Resistance J.Biol.Chem., 278, 2003
|
|
5NV6
| Structure of human transforming growth factor beta-induced protein (TGFBIp). | Descriptor: | ACETATE ION, Transforming growth factor-beta-induced protein ig-h3 | Authors: | Garcia-Castellanos, R, Nielsen, S.N, Runager, K, Thogersen, B.I, Goulas, T, Enghild, J.J, Gomis-Ruth, F.X. | Deposit date: | 2017-05-03 | Release date: | 2017-08-09 | Last modified: | 2024-01-17 | Method: | X-RAY DIFFRACTION (2.93 Å) | Cite: | Structural and Functional Implications of Human Transforming Growth Factor beta-Induced Protein, TGFBIp, in Corneal Dystrophies. Structure, 25, 2017
|
|
2J83
| Ulilysin metalloprotease in complex with batimastat. | Descriptor: | 4-(N-HYDROXYAMINO)-2R-ISOBUTYL-2S-(2-THIENYLTHIOMETHYL)SUCCINYL-L-PHENYLALANINE-N-METHYLAMIDE, CALCIUM ION, GLYCEROL, ... | Authors: | Garcia-Castellanos, R, Tallant, C, Marrero, A, Sola, M, Baumann, U, Gomis-Ruth, F.X. | Deposit date: | 2006-10-18 | Release date: | 2006-12-19 | Last modified: | 2023-12-13 | Method: | X-RAY DIFFRACTION (2 Å) | Cite: | Substrate Specificity of a Metalloprotease of the Pappalysin Family Revealed by an Inhibitor and a Product Complex. Arch.Biochem.Biophys., 457, 2007
|
|
3LUM
| Structure of ulilysin mutant M290L | Descriptor: | ARGININE, CALCIUM ION, GLYCEROL, ... | Authors: | Tallant, C, Garcia-Castellanos, R, Baumann, U, Gomis-Ruth, F.X. | Deposit date: | 2010-02-18 | Release date: | 2010-03-02 | Last modified: | 2023-11-01 | Method: | X-RAY DIFFRACTION (1.7 Å) | Cite: | On the relevance of the Met-turn methionine in metzincins. J.Biol.Chem., 285, 2010
|
|
3LUN
| Structure of ulilysin mutant M290C | Descriptor: | ARGININE, CALCIUM ION, GLYCEROL, ... | Authors: | Tallant, C, Garcia-Castellanos, R, Baumann, U, Gomis-Ruth, F.X. | Deposit date: | 2010-02-18 | Release date: | 2010-03-02 | Last modified: | 2023-11-01 | Method: | X-RAY DIFFRACTION (1.8 Å) | Cite: | On the relevance of the Met-turn methionine in metzincins. J.Biol.Chem., 285, 2010
|
|
2BO9
| Human carboxypeptidase A4 in complex with human latexin. | Descriptor: | (4S)-2-METHYL-2,4-PENTANEDIOL, 2-acetamido-2-deoxy-beta-D-glucopyranose, ACETONE, ... | Authors: | Pallares, I, Bonet, R, Garcia-Castellanos, R, Ventura, S, Aviles, F.X, Vendrell, J, Gomis-Rueth, F.X. | Deposit date: | 2005-04-08 | Release date: | 2005-04-15 | Last modified: | 2020-07-29 | Method: | X-RAY DIFFRACTION (1.6 Å) | Cite: | Structure of Human Carboxypeptidase A4 with its Endogenous Protein Inhibitor, Latexin. Proc.Natl.Acad.Sci.USA, 102, 2005
|
|
2CKI
| Structure of Ulilysin, a member of the pappalysin family of metzincin metalloendopeptidases. | Descriptor: | ARGININE, CALCIUM ION, GLYCEROL, ... | Authors: | Tallant, C, Garcia-Castellanos, R, Seco, J, Baumann, U, Gomis-Ruth, F.X. | Deposit date: | 2006-04-19 | Release date: | 2006-05-09 | Last modified: | 2019-05-08 | Method: | X-RAY DIFFRACTION (1.7 Å) | Cite: | Molecular Analysis of Ulilysin, the Structural Prototype of a New Family of Metzincin Metalloproteases. J.Biol.Chem., 281, 2006
|
|
2IWA
| Unbound glutaminyl cyclotransferase from Carica papaya. | Descriptor: | 2-acetamido-2-deoxy-beta-D-glucopyranose, CALCIUM ION, GLUTAMINE CYCLOTRANSFERASE, ... | Authors: | Guevara, T, Mallorqui-Fernandez, N, Garcia-Castellanos, R, Petersen, G.E, Lauritzen, C, Pedersen, J, Arnau, J, Gomis-Ruth, F.X, Sola, M. | Deposit date: | 2006-06-27 | Release date: | 2006-07-04 | Last modified: | 2020-07-29 | Method: | X-RAY DIFFRACTION (1.6 Å) | Cite: | Papaya Glutamine Cyclotransferase Shows a Singular Five-Fold Beta-Propeller Architecture that Suggests a Novel Reaction Mechanism. Biol.Chem., 387, 2006
|
|
2IWD
| Oxacilloyl-acylated MecR1 extracellular antibiotic-sensor domain. | Descriptor: | (2R,4S)-5,5-dimethyl-2-[(1R)-1-{[(5-methyl-3-phenyl-1,2-oxazol-4-yl)carbonyl]amino}-2-oxoethyl]-1,3-thiazolidine-4-carb oxylic acid, Methicillin resistance mecR1 protein | Authors: | Marrero, A, Mallorqui-Fernandez, G, Guevara, T, Garcia-Castellanos, R, Gomis-Ruth, F.X. | Deposit date: | 2006-06-27 | Release date: | 2006-07-03 | Last modified: | 2023-12-13 | Method: | X-RAY DIFFRACTION (2.4 Å) | Cite: | Unbound and Acylated Structures of the Mecr1 Extracellular Antibiotic-Sensor Domain Provide Insights Into the Signal-Transduction System that Triggers Methicillin Resistance. J.Mol.Biol., 361, 2006
|
|
2IWB
| MecR1 unbound extracellular antibiotic-sensor domain. | Descriptor: | GLYCEROL, METHICILLIN RESISTANCE MECR1 PROTEIN, NICKEL (II) ION, ... | Authors: | Marrero, A, Mallorqui-Fernandez, G, Guevara, T, Garcia-Castellanos, R, Gomis-Ruth, F.X. | Deposit date: | 2006-06-27 | Release date: | 2006-07-04 | Last modified: | 2023-12-13 | Method: | X-RAY DIFFRACTION (1.8 Å) | Cite: | Unbound and Acylated Structures of the Mecr1 Extracellular Antibiotic-Sensor Domain Provide Insights Into the Signal-Transduction System that Triggers Methicillin Resistance. J.Mol.Biol., 361, 2006
|
|
2IWC
| Benzylpenicilloyl-acylated MecR1 extracellular antibiotic-sensor domain. | Descriptor: | METHICILLIN RESISTANCE MECR1 PROTEIN, OPEN FORM - PENICILLIN G | Authors: | Marrero, A, Mallorqui-Fernandez, G, Guevara, T, Garcia-Castellanos, R, Gomis-Ruth, F.X. | Deposit date: | 2006-06-27 | Release date: | 2006-07-04 | Last modified: | 2023-12-13 | Method: | X-RAY DIFFRACTION (2.1 Å) | Cite: | Unbound and Acylated Structures of the Mecr1 Extracellular Antibiotic-Sensor Domain Provide Insights Into the Signal-Transduction System that Triggers Methicillin Resistance. J.Mol.Biol., 361, 2006
|
|