3VN4
 
 | | Crystal structure of the exosite-containing fragment of human ADAMTS13 (P475S mutant) | | Descriptor: | 2-acetamido-2-deoxy-beta-D-glucopyranose, 2-acetamido-2-deoxy-beta-D-glucopyranose-(1-4)-2-acetamido-2-deoxy-beta-D-glucopyranose, A disintegrin and metalloproteinase with thrombospondin motifs 13, ... | | Authors: | Nakayama, D, Akiyama, M, Takeda, S, Kokame, K, Takagi, J, Miyata, T. | | Deposit date: | 2011-12-21 | | Release date: | 2012-12-26 | | Last modified: | 2024-07-31 | | Method: | X-RAY DIFFRACTION (2.8 Å) | | Cite: | Crystal structure and enzymatic activity of an ADAMTS-13 mutant with the East Asian-specific P475S polymorphism.
J.Thromb.Haemost., 11, 2013
|
|
5E2E
 | | Crystal Structure of Beta-lactamase Precursor BlaA from Yersinia enterocolitica | | Descriptor: | Beta-lactamase | | Authors: | Kim, Y, Joachimiak, G, Endres, M, Babnigg, G, Joachimiak, A, Midwest Center for Structural Genomics (MCSG) | | Deposit date: | 2015-10-01 | | Release date: | 2015-10-28 | | Last modified: | 2022-04-13 | | Method: | X-RAY DIFFRACTION (1.9 Å) | | Cite: | Crystal Structure of Beta-lactamase Precursor BlaA from Yersinia enterocolitica
To Be Published
|
|
5NUL
 | | CLOSTRIDIUM BEIJERINCKII FLAVODOXIN MUTANT: G57T SEMIQUINONE (150K) | | Descriptor: | FLAVIN MONONUCLEOTIDE, FLAVODOXIN | | Authors: | Ludwig, M.L, Pattridge, K.A, Metzger, A.L, Dixon, M.M, Eren, M, Feng, Y, Swenson, R. | | Deposit date: | 1996-12-20 | | Release date: | 1997-03-12 | | Last modified: | 2024-05-22 | | Method: | X-RAY DIFFRACTION (1.6 Å) | | Cite: | Control of oxidation-reduction potentials in flavodoxin from Clostridium beijerinckii: the role of conformation changes.
Biochemistry, 36, 1997
|
|
7DCE
 | | Cryo-EM structure of human XKR8-basigin complex bound to Fab fragment | | Descriptor: | 1,2-DILINOLEOYL-SN-GLYCERO-3-PHOSPHOCHOLINE, Heavy chain of Fab fragment, Isoform 2 of Basigin, ... | | Authors: | Sakuragi, T, Kanai, R, Tsutsumi, A, Narita, H, Onishi, E, Miyazaki, T, Baba, T, Nakagawa, A, Kikkawa, M, Toyoshima, C, Nagata, S. | | Deposit date: | 2020-10-26 | | Release date: | 2021-10-20 | | Last modified: | 2024-01-24 | | Method: | ELECTRON MICROSCOPY (3.8 Å) | | Cite: | The tertiary structure of the human Xkr8-Basigin complex that scrambles phospholipids at plasma membranes.
Nat.Struct.Mol.Biol., 28, 2021
|
|
1SE3
 | | STAPHYLOCOCCAL ENTEROTOXIN B COMPLEXED WITH GM3 TRISACCHARIDE | | Descriptor: | N-acetyl-alpha-neuraminic acid-(2-3)-beta-D-galactopyranose-(1-4)-beta-D-glucopyranose, STAPHYLOCOCCAL ENTEROTOXIN B | | Authors: | Swaminathan, S, Sax, M. | | Deposit date: | 1996-10-11 | | Release date: | 1997-06-16 | | Last modified: | 2020-07-29 | | Method: | X-RAY DIFFRACTION (2.3 Å) | | Cite: | Residues defining V beta specificity in staphylococcal enterotoxins.
Nat.Struct.Biol., 2, 1995
|
|
3A5U
 | | Promiscuity and specificity in DNA binding to SSB: Insights from the structure of the Mycobacterium smegmatis SSB-ssDNA complex | | Descriptor: | DNA (31-MER), Single-stranded DNA-binding protein | | Authors: | Kaushal, P.S, Manjunath, G.P, Sekar, K, Muniyappa, K, Vijayan, M. | | Deposit date: | 2009-08-12 | | Release date: | 2010-08-18 | | Last modified: | 2023-11-01 | | Method: | X-RAY DIFFRACTION (2.8 Å) | | Cite: | Promiscuity and specificity in DNA binding to SSB: Insights from the structure of the Mycobacterium smegmatis SSB-ssDNA complex.
To be Published, 2009
|
|
7DBJ
 | | Crystal structure of human LDHB in complex with NADH, oxamate, and AXKO-0046 | | Descriptor: | 1,2-ETHANEDIOL, 1,4-DIHYDRONICOTINAMIDE ADENINE DINUCLEOTIDE, L-lactate dehydrogenase B chain, ... | | Authors: | Sogabe, S, Miwa, M. | | Deposit date: | 2020-10-20 | | Release date: | 2021-10-20 | | Last modified: | 2023-11-29 | | Method: | X-RAY DIFFRACTION (1.551 Å) | | Cite: | Identification of the first highly selective inhibitor of human lactate dehydrogenase B.
Sci Rep, 11, 2021
|
|
5E4F
 | |
5DO5
 | |
7DBK
 | | Crystal structure of human LDHB in complex with NADH | | Descriptor: | 1,4-DIHYDRONICOTINAMIDE ADENINE DINUCLEOTIDE, GLYCEROL, L-lactate dehydrogenase B chain | | Authors: | Sogabe, S, Miwa, M. | | Deposit date: | 2020-10-20 | | Release date: | 2021-10-20 | | Last modified: | 2023-11-29 | | Method: | X-RAY DIFFRACTION (1.802 Å) | | Cite: | Identification of the first highly selective inhibitor of human lactate dehydrogenase B.
Sci Rep, 11, 2021
|
|
5DOI
 | | Crystal structure of Tetrahymena p45N and p19 | | Descriptor: | Telomerase associated protein p45, Telomerase-associated protein 19 | | Authors: | Wan, B, Tang, T, Wu, J, Lei, M. | | Deposit date: | 2015-09-11 | | Release date: | 2015-11-25 | | Last modified: | 2024-03-20 | | Method: | X-RAY DIFFRACTION (2.2 Å) | | Cite: | The Tetrahymena telomerase p75-p45-p19 subcomplex is a unique CST complex
Nat.Struct.Mol.Biol., 22, 2015
|
|
3VBZ
 | | Crystal structure of Taipoxin beta subunit isoform 2 | | Descriptor: | Phospholipase A2 homolog, taipoxin beta chain | | Authors: | Cendron, L, Micetic, I, Polverino, P, Beltramini, M, Paoli, M. | | Deposit date: | 2012-01-03 | | Release date: | 2012-07-25 | | Last modified: | 2023-09-13 | | Method: | X-RAY DIFFRACTION (1.76 Å) | | Cite: | Structural analysis of trimeric phospholipase A(2) neurotoxin from the Australian taipan snake venom.
Febs J., 279, 2012
|
|
5O1Q
 | | LysF1 sh3b domain structure | | Descriptor: | sh3b domain | | Authors: | Benesik, M, Novacek, J, Janda, L, Dopitova, R, Pernisova, M, Melkova, K, Tisakova, L, Doskar, J, Zidek, L, Hejatko, J, Pantucek, R. | | Deposit date: | 2017-05-19 | | Release date: | 2017-09-20 | | Last modified: | 2024-06-19 | | Method: | SOLUTION NMR | | Cite: | Role of SH3b binding domain in a natural deletion mutant of Kayvirus endolysin LysF1 with a broad range of lytic activity.
Virus Genes, 54, 2018
|
|
1SAX
 | | Three-dimensional structure of s.aureus methicillin-resistance regulating transcriptional repressor meci in complex with 25-bp ds-DNA | | Descriptor: | 5'-d(CAAAATTACAACTGTAATATCGGAG)-3', 5'-d(GCTCCGATATTACAGTTGTAATTTT)-3', Methicillin resistance regulatory protein mecI, ... | | Authors: | Garcia-Castellanos, R, Mallorqui-Fernandez, G, Marrero, A, Potempa, J, Coll, M, Gomis-Ruth, F.X. | | Deposit date: | 2004-02-09 | | Release date: | 2004-04-27 | | Last modified: | 2023-08-23 | | Method: | X-RAY DIFFRACTION (2.8 Å) | | Cite: | On the transcriptional regulation of methicillin resistance: MecI repressor in complex with its operator
J.Biol.Chem., 279, 2004
|
|
5DPM
 | |
5DS0
 | | Crystal structure of TET aminopeptidase from marine sediment archaeon Thaumarchaeota archaeon SCGC AB-539-E09 | | Descriptor: | COBALT (II) ION, GLYCEROL, Peptidase M42 | | Authors: | Michalska, K, Chhor, G, Mootz, J, Endres, M, Jedrzejczak, R, Babnigg, G, Steen, A, Lloyd, K, Joachimiak, A, Midwest Center for Structural Genomics (MCSG) | | Deposit date: | 2015-09-16 | | Release date: | 2015-10-14 | | Last modified: | 2023-11-15 | | Method: | X-RAY DIFFRACTION (2.8 Å) | | Cite: | Crystal structure of TET aminopeptidase from marine sediment archaeon Thaumarchaeota archaeon SCGC AB-539-E09
To Be Published
|
|
5DQG
 | | Crystal Structure of Human DNA Polymerase Eta Inserting dAMPNPP Opposite O4-Ethylthymidine | | Descriptor: | 2'-deoxy-5'-O-[(R)-hydroxy{[(R)-hydroxy(phosphonooxy)phosphoryl]amino}phosphoryl]adenosine, DNA (5'-D(*AP*GP*CP*GP*TP*CP*AP*T)-3'), DNA (5'-D(*CP*AP*TP*(5EJ)P*AP*TP*GP*AP*CP*GP*CP*T)-3'), ... | | Authors: | Patra, A, OFlaherty, D.K, Egli, M. | | Deposit date: | 2015-09-14 | | Release date: | 2016-08-10 | | Last modified: | 2023-09-27 | | Method: | X-RAY DIFFRACTION (2.29 Å) | | Cite: | Lesion Orientation ofO4-Alkylthymidine Influences Replication by Human DNA Polymeraseeta.
Chem Sci, 7, 2016
|
|
7DKD
 | | Stenotrophomonas maltophilia DPP7 in complex with Asn-Tyr | | Descriptor: | ASPARAGINE, Dipeptidyl-peptidase, GLYCEROL, ... | | Authors: | Sakamoto, Y, Nakamura, A, Suzuki, Y, Honma, N, Roppongi, S, Kushibiki, C, Yonezawa, N, Takahashi, M, Shida, Y, Gouda, H, Nonaka, T, Ogasawara, W, Tanaka, N. | | Deposit date: | 2020-11-23 | | Release date: | 2021-11-03 | | Last modified: | 2023-11-29 | | Method: | X-RAY DIFFRACTION (1.92 Å) | | Cite: | Structural basis for an exceptionally strong preference for asparagine residue at the S2 subsite of Stenotrophomonas maltophilia dipeptidyl peptidase 7.
Sci Rep, 11, 2021
|
|
7DKC
 | | Stenotrophomonas maltophilia DPP7 in complex with Tyr-Tyr | | Descriptor: | Dipeptidyl-peptidase, GLYCEROL, TYROSINE | | Authors: | Sakamoto, Y, Nakamura, A, Suzuki, Y, Honma, N, Roppongi, S, Kushibiki, C, Yonezawa, N, Takahashi, M, Shida, Y, Gouda, H, Nonaka, T, Ogasawara, W, Tanaka, N. | | Deposit date: | 2020-11-23 | | Release date: | 2021-11-03 | | Last modified: | 2023-11-29 | | Method: | X-RAY DIFFRACTION (1.86 Å) | | Cite: | Structural basis for an exceptionally strong preference for asparagine residue at the S2 subsite of Stenotrophomonas maltophilia dipeptidyl peptidase 7.
Sci Rep, 11, 2021
|
|
5DLG
 | | Crystal Structure of Human DNA Polymerase Eta Inserting dGMPNPP Opposite O4-Methylhymidine | | Descriptor: | 2'-deoxy-5'-O-[(R)-hydroxy{[(R)-hydroxy(phosphonooxy)phosphoryl]amino}phosphoryl]guanosine, DNA (5'-D(*AP*GP*CP*GP*TP*CP*AP*T)-3'), DNA (5'-D(*CP*AP*TP*(5DB)P*AP*TP*GP*AP*CP*GP*CP*T)-3'), ... | | Authors: | Patra, A, OFlaherty, D.K, Egli, M. | | Deposit date: | 2015-09-04 | | Release date: | 2016-08-10 | | Last modified: | 2023-09-27 | | Method: | X-RAY DIFFRACTION (2.351 Å) | | Cite: | Lesion Orientation ofO4-Alkylthymidine Influences Replication by Human DNA Polymeraseeta.
Chem Sci, 7, 2016
|
|
5DK6
 | | CRYSTAL STRUCTURE OF A 5'-METHYLTHIOADENOSINE/S-ADENOSYLHOMOCYSTEINE (MTA/SAH) NUCLEOSIDASE (MTAN) FROM COLWELLIA PSYCHRERYTHRAEA 34H (CPS_4743, TARGET PSI-029300) IN COMPLEX WITH ADENINE AT 2.27 A RESOLUTION | | Descriptor: | 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase, ADENINE, GLYCINE | | Authors: | Himmel, D.M, Bhosle, R, Toro, R, Ahmed, M, Hillerich, B, Gizzi, A, Garforth, S, Kar, A, Chan, M.K, Lafluer, J, Patel, H, Matikainen, B, Chamala, S, Lim, S, Celikgil, A, Villegas, G, Evans, B, Love, J, Fiser, A, Seidel, R.D, Bonanno, J.B, Almo, S.C, New York Structural Genomics Research Consortium (NYSGRC) | | Deposit date: | 2015-09-03 | | Release date: | 2015-11-04 | | Method: | X-RAY DIFFRACTION (2.27 Å) | | Cite: | CRYSTAL STRUCTURE OF A 5'-METHYLTHIOADENOSINE/S-ADENOSYLHOMOCYSTEINE (MTA/SAH)NUCLEOSIDASE (MTAN) FROM COLWELLIA PSYCHRERYTHRAEA 34H (CPS_4743, TARGET PSI-029300) IN COMPLEX WITH ADENINE AT 2.27 A RESOLUTION
To be published
|
|
5DKC
 | | Crystal structure of the bromodomain of human BRM (SMARCA2) in complex with PFI-3 chemical probe | | Descriptor: | (2E)-1-(2-hydroxyphenyl)-3-[(1R,4R)-5-(pyridin-2-yl)-2,5-diazabicyclo[2.2.1]hept-2-yl]prop-2-en-1-one, Probable global transcription activator SNF2L2, ZINC ION | | Authors: | Tallant, C, Owen, D.R, Gerstenberger, B.S, Fedorov, O, Savitsky, P, Nunez-Alonso, G, Fonseca, M, Krojer, T, Filippakopoulos, P, von Delft, F, Arrowsmith, C.H, Edwards, A.M, Bountra, C, Muller, S, Knapp, S. | | Deposit date: | 2015-09-03 | | Release date: | 2015-10-14 | | Last modified: | 2024-01-10 | | Method: | X-RAY DIFFRACTION (1.6 Å) | | Cite: | Crystal structure of the bromodomain of human BRM (SMARCA2) in complex with PFI-3 chemical probe
To Be Published
|
|
7DKE
 | | Stenotrophomonas maltophilia DPP7 in complex with Phe-Tyr | | Descriptor: | Dipeptidyl-peptidase, GLYCEROL, PHENYLALANINE, ... | | Authors: | Sakamoto, Y, Nakamura, A, Suzuki, Y, Honma, N, Roppongi, S, Kushibiki, C, Yonezawa, N, Takahashi, M, Shida, Y, Gouda, H, Nonaka, T, Ogasawara, W, Tanaka, N. | | Deposit date: | 2020-11-23 | | Release date: | 2021-11-03 | | Last modified: | 2023-11-29 | | Method: | X-RAY DIFFRACTION (1.91 Å) | | Cite: | Structural basis for an exceptionally strong preference for asparagine residue at the S2 subsite of Stenotrophomonas maltophilia dipeptidyl peptidase 7.
Sci Rep, 11, 2021
|
|
7DDM
 | | Crystal Structure of PenA39 beta-Lactamase | | Descriptor: | (4S)-2-METHYL-2,4-PENTANEDIOL, ACETATE ION, ALA-ALA-ARG-ASP-ALA-ALA-VAL-SER-ASP-ALA-ALA-ALA, ... | | Authors: | Nukaga, M, Hoshino, T, Papp-Wallace, K.M. | | Deposit date: | 2020-10-29 | | Release date: | 2021-11-03 | | Last modified: | 2023-11-29 | | Method: | X-RAY DIFFRACTION (1.2 Å) | | Cite: | Frameshift mutations in genes encoding PBP3 and PBP4 trigger an unusual, extreme beta-lactam resistance phenotype in Burkholderia multivorans
To Be Published
|
|
7DKB
 | | Stenotrophomonas maltophilia DPP7 in complex with Val-Tyr | | Descriptor: | Dipeptidyl-peptidase, TYROSINE, VALINE | | Authors: | Sakamoto, Y, Nakamura, A, Suzuki, Y, Honma, N, Roppongi, S, Kushibiki, C, Yonezawa, N, Takahashi, M, Shida, Y, Gouda, H, Nonaka, T, Ogasawara, W, Tanaka, N. | | Deposit date: | 2020-11-23 | | Release date: | 2021-11-03 | | Last modified: | 2023-11-29 | | Method: | X-RAY DIFFRACTION (2.03 Å) | | Cite: | Structural basis for an exceptionally strong preference for asparagine residue at the S2 subsite of Stenotrophomonas maltophilia dipeptidyl peptidase 7.
Sci Rep, 11, 2021
|
|
