2IWD
 
 | | Oxacilloyl-acylated MecR1 extracellular antibiotic-sensor domain. | | Descriptor: | (2R,4S)-5,5-dimethyl-2-[(1R)-1-{[(5-methyl-3-phenyl-1,2-oxazol-4-yl)carbonyl]amino}-2-oxoethyl]-1,3-thiazolidine-4-carb oxylic acid, Methicillin resistance mecR1 protein | | Authors: | Marrero, A, Mallorqui-Fernandez, G, Guevara, T, Garcia-Castellanos, R, Gomis-Ruth, F.X. | | Deposit date: | 2006-06-27 | | Release date: | 2006-07-03 | | Last modified: | 2024-11-13 | | Method: | X-RAY DIFFRACTION (2.4 Å) | | Cite: | Unbound and Acylated Structures of the Mecr1 Extracellular Antibiotic-Sensor Domain Provide Insights Into the Signal-Transduction System that Triggers Methicillin Resistance.
J.Mol.Biol., 361, 2006
|
|
2XS3
 | | Structure of karilysin catalytic MMP domain | | Descriptor: | 2-AMINO-2-HYDROXYMETHYL-PROPANE-1,3-DIOL, KARILYSIN PROTEASE, PEPTIDE ALA-PHE-THR-SER, ... | | Authors: | Cerda-Costa, N, Guevara, T, Karim, A.Y, Ksiazek, M, Nguyen, K.-A, Arolas, J.L, Potempa, J, Gomis-Ruth, F.X. | | Deposit date: | 2010-09-24 | | Release date: | 2010-11-03 | | Last modified: | 2023-12-20 | | Method: | X-RAY DIFFRACTION (2.4 Å) | | Cite: | The Structure of the Catalytic Domain of Tannerella Forsythia Karilysin Reveals It is a Bacterial Xenologue of Animal Matrix Metalloproteinases.
Mol.Microbiol., 79, 2011
|
|
2XS4
 | | Structure of karilysin catalytic MMP domain in complex with magnesium | | Descriptor: | CHLORIDE ION, KARILYSIN PROTEASE, MAGNESIUM ION, ... | | Authors: | Cerda-Costa, N, Guevara, T, Karim, A.Y, Ksiazek, M, Nguyen, K.-A, Arolas, J.L, Potempa, J, Gomis-Ruth, F.X. | | Deposit date: | 2010-09-24 | | Release date: | 2010-11-03 | | Last modified: | 2023-12-20 | | Method: | X-RAY DIFFRACTION (1.7 Å) | | Cite: | The Structure of the Catalytic Domain of Tannerella Forsythia Karilysin Reveals It is a Bacterial Xenologue of Animal Matrix Metalloproteinases.
Mol.Microbiol., 79, 2011
|
|
2RNF
 | | X-RAY CRYSTAL STRUCTURE OF HUMAN RIBONUCLEASE 4 IN COMPLEX WITH D(UP) | | Descriptor: | 2'-DEOXYURIDINE 3'-MONOPHOSPHATE, RIBONUCLEASE 4 | | Authors: | Terzyan, S.S, Peracaula, R, De Llorens, R, Tsushima, Y, Yamada, H, Seno, M, Gomis-Ruth, F.X, Coll, M. | | Deposit date: | 1998-11-03 | | Release date: | 1999-11-10 | | Last modified: | 2024-11-20 | | Method: | X-RAY DIFFRACTION (2.4 Å) | | Cite: | The three-dimensional structure of human RNase 4, unliganded and complexed with d(Up), reveals the basis for its uridine selectivity.
J.Mol.Biol., 285, 1999
|
|
3P24
 | | Structure of profragilysin-3 from Bacteroides fragilis | | Descriptor: | AZIDE ION, BFT-3, GLYCEROL, ... | | Authors: | Goulas, T, Arolas, J.L, Gomis-Ruth, F.X. | | Deposit date: | 2010-10-01 | | Release date: | 2010-12-29 | | Last modified: | 2024-02-21 | | Method: | X-RAY DIFFRACTION (1.8 Å) | | Cite: | Structure, function and latency regulation of a bacterial enterotoxin potentially derived from a mammalian adamalysin/ADAM xenolog.
Proc.Natl.Acad.Sci.USA, 108, 2011
|
|
3RAM
 | | Crystal structure of HmrA | | Descriptor: | GLYCEROL, HmrA protein, ZINC ION | | Authors: | Botelho, T, Guevara, T, Marrero, A, Gomis-Ruth, F.X. | | Deposit date: | 2011-03-28 | | Release date: | 2011-05-25 | | Last modified: | 2024-11-20 | | Method: | X-RAY DIFFRACTION (2.7 Å) | | Cite: | Structural and Functional Analyses Reveal That Staphylococcus aureus Antibiotic Resistance Factor HmrA Is a Zinc-dependent Endopeptidase.
J.Biol.Chem., 286, 2011
|
|
7ZVB
 | | Crystal Structure of the mature form of the glutamic-class prolyl-endopeptidase neprosin at 2.35 A resolution. | | Descriptor: | 2-acetamido-2-deoxy-beta-D-glucopyranose, C-terminal peptidase, TRIETHYLENE GLYCOL, ... | | Authors: | Del Amo-Maestro, L, Eckhard, U, Rodriguez-Banqueri, A, Mendes, S.R, Guevara, T, Gomis-Ruth, F.X. | | Deposit date: | 2022-05-14 | | Release date: | 2022-08-10 | | Last modified: | 2024-10-16 | | Method: | X-RAY DIFFRACTION (2.35 Å) | | Cite: | Molecular and in vivo studies of a glutamate-class prolyl-endopeptidase for coeliac disease therapy.
Nat Commun, 13, 2022
|
|
6R7W
 | | Tannerella forsythia mature mirolysin in complex with a cleaved peptide. | | Descriptor: | CALCIUM ION, CITRIC ACID, ETHANOL, ... | | Authors: | Rodriguez-Banqueri, A, Guevara, T, Ksiazek, M, Potempa, J, Gomis-Ruth, F.X. | | Deposit date: | 2019-03-29 | | Release date: | 2019-11-13 | | Last modified: | 2024-11-20 | | Method: | X-RAY DIFFRACTION (1.5 Å) | | Cite: | Structure-based mechanism of cysteine-switch latency and of catalysis by pappalysin-family metallopeptidases.
Iucrj, 7, 2020
|
|
6R7U
 | | Selenomethionine variant of Tannerella forsythia promirolysin mutant E225A | | Descriptor: | BORIC ACID, CALCIUM ION, GLYCEROL, ... | | Authors: | Rodriguez-Banqueri, A, Guevara, T, Ksiazek, M, Potempa, J, Gomis-Ruth, F.X. | | Deposit date: | 2019-03-29 | | Release date: | 2020-02-05 | | Last modified: | 2024-01-24 | | Method: | X-RAY DIFFRACTION (1.6 Å) | | Cite: | Structure-based mechanism of cysteine-switch latency and of catalysis by pappalysin-family metallopeptidases.
Iucrj, 7, 2020
|
|
6R7V
 | | Tannerella forsythia promirolysin mutant E225A | | Descriptor: | CALCIUM ION, GLYCEROL, Mirolysin, ... | | Authors: | Rodriguez-Banqueri, A, Guevara, T, Ksiazek, M, Potempa, J, Gomis-Ruth, F.X. | | Deposit date: | 2019-03-29 | | Release date: | 2019-11-13 | | Last modified: | 2024-10-23 | | Method: | X-RAY DIFFRACTION (1.4 Å) | | Cite: | Structure-based mechanism of cysteine-switch latency and of catalysis by pappalysin-family metallopeptidases.
Iucrj, 7, 2020
|
|
7ZVC
 | | Second crystal form of the mature glutamic-class prolyl-endopeptidase neprosin at 1.85 A resolution. | | Descriptor: | 2-acetamido-2-deoxy-beta-D-glucopyranose, C-terminal peptidase, GLY-GLY-GLY-GLY, ... | | Authors: | Rodriguez-Banqueri, A, Eckhard, U, Del Amo-Maestro, L, Mendes, S.R, Guevara, T, Gomis-Ruth, F.X. | | Deposit date: | 2022-05-14 | | Release date: | 2022-08-10 | | Last modified: | 2024-11-20 | | Method: | X-RAY DIFFRACTION (1.85 Å) | | Cite: | Molecular and in vivo studies of a glutamate-class prolyl-endopeptidase for coeliac disease therapy.
Nat Commun, 13, 2022
|
|
7ZVA
 | | Crystal Structure of the native zymogen form of the glutamic-class prolyl-endopeptidase neprosin at 1.80 A resolution. | | Descriptor: | 2-acetamido-2-deoxy-beta-D-glucopyranose-(1-4)-2-acetamido-2-deoxy-beta-D-glucopyranose, ACETATE ION, C-terminal peptidase, ... | | Authors: | Del Amo-Maestro, L, Eckhard, U, Rodriguez-Banqueri, A, Mendes, S.R, Guevara, T, Gomis-Ruth, F.X. | | Deposit date: | 2022-05-14 | | Release date: | 2022-08-10 | | Last modified: | 2024-10-16 | | Method: | X-RAY DIFFRACTION (1.8 Å) | | Cite: | Molecular and in vivo studies of a glutamate-class prolyl-endopeptidase for coeliac disease therapy.
Nat Commun, 13, 2022
|
|
7ZU8
 | | Crystal Structure of the zymogen form of the glutamic-class prolyl-endopeptidase neprosin at 2.05 A resolution in presence of the crystallophore Lu-Xo4. | | Descriptor: | 12-oxidanyl-9,11$l^{3}-dioxa-1$l^{4},19$l^{4},22,27$l^{4},28$l^{4}-pentaza-10$l^{6}-lutetaoctacyclo[17.5.2.1^{3,7}.1^{10,13}.0^{1,10}.0^{10,19}.0^{10,28}.0^{17,27}]octacosa-3,5,7(28),11,13,15,17(27)-heptaen-8-one, 2-acetamido-2-deoxy-beta-D-glucopyranose-(1-4)-2-acetamido-2-deoxy-beta-D-glucopyranose, 2-acetamido-2-deoxy-beta-D-glucopyranose-(1-4)-[alpha-L-fucopyranose-(1-6)]2-acetamido-2-deoxy-beta-D-glucopyranose, ... | | Authors: | Del Amo-Maestro, L, Eckhard, U, Rodriguez-Banqueri, A, Mendes, S.R, Guevara, T, Gomis-Ruth, F.X. | | Deposit date: | 2022-05-11 | | Release date: | 2022-08-10 | | Last modified: | 2024-11-13 | | Method: | X-RAY DIFFRACTION (2.05 Å) | | Cite: | Molecular and in vivo studies of a glutamate-class prolyl-endopeptidase for coeliac disease therapy.
Nat Commun, 13, 2022
|
|
4GWM
 | | Crystal structure of human promeprin beta | | Descriptor: | 2-acetamido-2-deoxy-beta-D-glucopyranose, 2-acetamido-2-deoxy-beta-D-glucopyranose-(1-4)-2-acetamido-2-deoxy-beta-D-glucopyranose, CHLORIDE ION, ... | | Authors: | Arolas, J.L, Broder, C, Jefferson, T, Guevara, T, Sterchi, E.E, Bode, W, Stocker, W, Becker-Pauly, C, Gomis-Ruth, F.X. | | Deposit date: | 2012-09-03 | | Release date: | 2012-09-19 | | Last modified: | 2024-10-30 | | Method: | X-RAY DIFFRACTION (1.85 Å) | | Cite: | Structural basis for the sheddase function of human meprin beta metalloproteinase at the plasma membrane
Proc.Natl.Acad.Sci.USA, 109, 2012
|
|
4HE5
 | | Crystal structure of the selenomethionine variant of the C-terminal domain of Geobacillus thermoleovorans putative U32 peptidase | | Descriptor: | Peptidase family U32, SULFATE ION | | Authors: | Trillo-Muyo, S, Jasilionis, A, Domagalski, M.J, Chruszcz, M, Minor, W, Kuisiene, N, Arolas, J.L, Sola, M, Gomis-Ruth, F.X. | | Deposit date: | 2012-10-03 | | Release date: | 2012-11-14 | | Last modified: | 2024-11-06 | | Method: | X-RAY DIFFRACTION (1.15 Å) | | Cite: | Ultratight crystal packing of a 10 kDa protein.
Acta Crystallogr.,Sect.D, 69, 2013
|
|
4HE6
 | | Crystal structure of the C-terminal domain of Geobacillus thermoleovorans putative U32 peptidase | | Descriptor: | ACETATE ION, Peptidase family U32, UNKNOWN ATOM OR ION | | Authors: | Trillo-Muyo, S, Jasilionis, A, Domagalski, M.J, Chruszcz, M, Minor, W, Kuisiene, N, Arolas, J.L, Sola, M, Gomis-Ruth, F.X. | | Deposit date: | 2012-10-03 | | Release date: | 2012-11-14 | | Last modified: | 2023-09-20 | | Method: | X-RAY DIFFRACTION (1.1 Å) | | Cite: | Ultratight crystal packing of a 10 kDa protein.
Acta Crystallogr.,Sect.D, 69, 2013
|
|
7SKN
 | |
7SKP
 | |
7SKO
 | | De novo synthetic protein DIG8-CC (orthogonal space group) | | Descriptor: | De novo synthetic protein DIG8-CC, MAGNESIUM ION | | Authors: | Mendes, S.R, Eckhard, U, Marcos, E, Gomis-Ruth, F.X. | | Deposit date: | 2021-10-21 | | Release date: | 2022-10-12 | | Last modified: | 2024-11-13 | | Method: | X-RAY DIFFRACTION (2.05 Å) | | Cite: | De novo design of immunoglobulin-like domains
Nat Commun, 13, 2022
|
|
4IN9
 | | Structure of karilysin MMP-like catalytic domain in complex with inhibitory tetrapeptide SWFP | | Descriptor: | GLYCEROL, Karilysin protease, POTASSIUM ION, ... | | Authors: | Guevara, T, Ksiazek, M, Skottrup, P.D, Cerda-Costa, N, Trillo-Muyo, S, de Diego, I, Riise, E, Potempa, J, Gomis-Ruth, F.X. | | Deposit date: | 2013-01-04 | | Release date: | 2013-05-15 | | Last modified: | 2023-09-20 | | Method: | X-RAY DIFFRACTION (1.55 Å) | | Cite: | Structure of the catalytic domain of the Tannerella forsythia matrix metallopeptidase karilysin in complex with a tetrapeptidic inhibitor.
Acta Crystallogr.,Sect.F, 69, 2013
|
|
7T8I
 | |
1SAX
 | | Three-dimensional structure of s.aureus methicillin-resistance regulating transcriptional repressor meci in complex with 25-bp ds-DNA | | Descriptor: | 5'-d(CAAAATTACAACTGTAATATCGGAG)-3', 5'-d(GCTCCGATATTACAGTTGTAATTTT)-3', Methicillin resistance regulatory protein mecI, ... | | Authors: | Garcia-Castellanos, R, Mallorqui-Fernandez, G, Marrero, A, Potempa, J, Coll, M, Gomis-Ruth, F.X. | | Deposit date: | 2004-02-09 | | Release date: | 2004-04-27 | | Last modified: | 2023-08-23 | | Method: | X-RAY DIFFRACTION (2.8 Å) | | Cite: | On the transcriptional regulation of methicillin resistance: MecI repressor in complex with its operator
J.Biol.Chem., 279, 2004
|
|
3LUM
 | | Structure of ulilysin mutant M290L | | Descriptor: | ARGININE, CALCIUM ION, GLYCEROL, ... | | Authors: | Tallant, C, Garcia-Castellanos, R, Baumann, U, Gomis-Ruth, F.X. | | Deposit date: | 2010-02-18 | | Release date: | 2010-03-02 | | Last modified: | 2024-10-30 | | Method: | X-RAY DIFFRACTION (1.7 Å) | | Cite: | On the relevance of the Met-turn methionine in metzincins.
J.Biol.Chem., 285, 2010
|
|
3LUN
 | | Structure of ulilysin mutant M290C | | Descriptor: | ARGININE, CALCIUM ION, GLYCEROL, ... | | Authors: | Tallant, C, Garcia-Castellanos, R, Baumann, U, Gomis-Ruth, F.X. | | Deposit date: | 2010-02-18 | | Release date: | 2010-03-02 | | Last modified: | 2024-10-09 | | Method: | X-RAY DIFFRACTION (1.8 Å) | | Cite: | On the relevance of the Met-turn methionine in metzincins.
J.Biol.Chem., 285, 2010
|
|
3LQ0
 | | Zymogen structure of crayfish astacin metallopeptidase | | Descriptor: | GLYCEROL, ProAstacin, SULFATE ION, ... | | Authors: | Guevara, T, Yiallouros, I, Kappelhoff, R, Bissdorf, S, Stocker, W, Gomis-Ruth, F.X. | | Deposit date: | 2010-02-08 | | Release date: | 2010-02-23 | | Last modified: | 2024-11-20 | | Method: | X-RAY DIFFRACTION (1.45 Å) | | Cite: | Proenzyme structure and activation of astacin metallopeptidase
J.Biol.Chem., 285, 2010
|
|
