5E3M
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 5e3m by Molmil](/molmil-images/mine/5e3m) | Crystal structure of Fis bound to 27bp DNA F35 (AAATTAGTTTGAATCTCGAGCTAATTT) | Descriptor: | DNA (27-MER), DNA-binding protein Fis | Authors: | Stella, S, Hancock, S.P, Cascio, D, Johnson, R.C. | Deposit date: | 2015-10-03 | Release date: | 2016-03-09 | Last modified: | 2024-05-22 | Method: | X-RAY DIFFRACTION (2.886 Å) | Cite: | DNA Sequence Determinants Controlling Affinity, Stability and Shape of DNA Complexes Bound by the Nucleoid Protein Fis. Plos One, 11, 2016
|
|
5EB1
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 5eb1 by Molmil](/molmil-images/mine/5eb1) | the YfiB-YfiR complex | Descriptor: | SULFATE ION, YfiB, YfiR | Authors: | Xu, M, Yang, X, Yang, X.-A, Zhou, L, Liu, T.-Z, Fan, Z, Jiang, T. | Deposit date: | 2015-10-17 | Release date: | 2016-05-18 | Last modified: | 2023-11-08 | Method: | X-RAY DIFFRACTION (1.8 Å) | Cite: | Structural insights into the regulatory mechanism of the Pseudomonas aeruginosa YfiBNR system Protein Cell, 7, 2016
|
|
5F74
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 5f74 by Molmil](/molmil-images/mine/5f74) | Crystal structure of ChREBP:14-3-3 complex bound with AMP | Descriptor: | 14-3-3 protein beta/alpha, ADENOSINE MONOPHOSPHATE, Carbohydrate-responsive element-binding protein | Authors: | Jung, H, Uyeda, K. | Deposit date: | 2015-12-07 | Release date: | 2016-03-23 | Last modified: | 2023-09-27 | Method: | X-RAY DIFFRACTION (2.35 Å) | Cite: | Metabolite Regulation of Nuclear Localization of Carbohydrate-response Element-binding Protein (ChREBP): ROLE OF AMP AS AN ALLOSTERIC INHIBITOR. J.Biol.Chem., 291, 2016
|
|
5F12
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 5f12 by Molmil](/molmil-images/mine/5f12) | WrbA in complex with FMN under crystallization conditions of WrbA-FMN-BQ structure (4YQE) | Descriptor: | FLAVIN MONONUCLEOTIDE, NAD(P)H dehydrogenase (quinone) | Authors: | Degtjarik, O, Brynda, J, Ettrichova, O, Kuta Smatanova, I, Carey, J, Ettrich, R. | Deposit date: | 2015-11-29 | Release date: | 2016-05-25 | Last modified: | 2024-01-10 | Method: | X-RAY DIFFRACTION (1.5 Å) | Cite: | Quantum Calculations Indicate Effective Electron Transfer between FMN and Benzoquinone in a New Crystal Structure of Escherichia coli WrbA. J.Phys.Chem.B, 120, 2016
|
|
5F6F
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 5f6f by Molmil](/molmil-images/mine/5f6f) | |
8BPB
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 8bpb by Molmil](/molmil-images/mine/8bpb) | Cryo-EM structure of the human SIN3B histone deacetylase core complex at 2.8 Angstrom | Descriptor: | ACETATE ION, CALCIUM ION, Histone deacetylase 2, ... | Authors: | Wan, M.S.M, Muhammad, R, Koliopolous, M.G, Alfieri, C. | Deposit date: | 2022-11-16 | Release date: | 2023-05-10 | Last modified: | 2024-03-27 | Method: | ELECTRON MICROSCOPY (2.8 Å) | Cite: | Mechanism of assembly, activation and lysine selection by the SIN3B histone deacetylase complex. Nat Commun, 14, 2023
|
|
8BPC
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 8bpc by Molmil](/molmil-images/mine/8bpc) | Cryo-EM structure of the human SIN3B histone deacetylase core complex with SAHA at 2.8 Angstrom | Descriptor: | CALCIUM ION, Histone deacetylase 2, Isoform 2 of Paired amphipathic helix protein Sin3b, ... | Authors: | Wan, M.S.M, Muhammad, R, Koliopolous, M.G, Alfieri, C. | Deposit date: | 2022-11-16 | Release date: | 2023-05-10 | Last modified: | 2024-07-24 | Method: | ELECTRON MICROSCOPY (2.8 Å) | Cite: | Mechanism of assembly, activation and lysine selection by the SIN3B histone deacetylase complex. Nat Commun, 14, 2023
|
|
5FO5
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 5fo5 by Molmil](/molmil-images/mine/5fo5) | Structure of the DNA-binding domain of Escherichia coli methionine biosynthesis regulator MetR | Descriptor: | 1,2-ETHANEDIOL, HTH-TYPE TRANSCRIPTIONAL REGULATOR METR, MAGNESIUM ION | Authors: | Punekar, A.S, Porter, J, Urbanowski, M.L, Stauffer, G.V, Carr, S.B, Phillips, S.E. | Deposit date: | 2015-11-18 | Release date: | 2016-06-08 | Last modified: | 2024-01-10 | Method: | X-RAY DIFFRACTION (2.16 Å) | Cite: | Structural Basis for DNA Recognition by the Transcription Regulator Metr. Acta Crystallogr.,Sect.F, 72, 2016
|
|
5FFZ
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 5ffz by Molmil](/molmil-images/mine/5ffz) | |
5FFX
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 5ffx by Molmil](/molmil-images/mine/5ffx) | |
3BTJ
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 3btj by Molmil](/molmil-images/mine/3btj) | |
5FCT
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 5fct by Molmil](/molmil-images/mine/5fct) | Mouse thymidylate synthase in ternary complex with FdUMP and methylenetetrahydrofolate. | Descriptor: | 5-FLUORO-2'-DEOXYURIDINE-5'-MONOPHOSPHATE, 5-METHYL-5,6,7,8-TETRAHYDROFOLIC ACID, Thymidylate synthase | Authors: | Dowiercial, A, Wilk, P, Jarmula, A, Rode, W. | Deposit date: | 2015-12-15 | Release date: | 2016-10-26 | Last modified: | 2024-01-10 | Method: | X-RAY DIFFRACTION (1.55 Å) | Cite: | Mouse thymidylate synthase does not show the inactive conformation, observed for the human enzyme Struct Chem, 2016
|
|
5FB2
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 5fb2 by Molmil](/molmil-images/mine/5fb2) | |
5DV4
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 5dv4 by Molmil](/molmil-images/mine/5dv4) | |
5EB3
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 5eb3 by Molmil](/molmil-images/mine/5eb3) | VB6-bound protein | Descriptor: | 4,5-bis(hydroxymethyl)-2-methyl-pyridin-3-ol, SULFATE ION, YfiR | Authors: | Xu, M, Yang, X, Yang, X.-A, Zhou, L, Liu, T.-Z, Fan, Z, Jiang, T. | Deposit date: | 2015-10-17 | Release date: | 2016-05-18 | Last modified: | 2023-11-08 | Method: | X-RAY DIFFRACTION (2.4 Å) | Cite: | Structural insights into the regulatory mechanism of the Pseudomonas aeruginosa YfiBNR system Protein Cell, 7, 2016
|
|
3BT9
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 3bt9 by Molmil](/molmil-images/mine/3bt9) | |
2OZ6
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 2oz6 by Molmil](/molmil-images/mine/2oz6) | |
5JWK
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 5jwk by Molmil](/molmil-images/mine/5jwk) | Factor Inhibiting HIF D201E in Complex with Fe, and Alpha-Ketoglutarate | Descriptor: | 2-OXOGLUTARIC ACID, DI(HYDROXYETHYL)ETHER, FE (II) ION, ... | Authors: | Taabazuing, C.Y, Garman, S.C, Knapp, M.J, Eron, S. | Deposit date: | 2016-05-12 | Release date: | 2017-05-17 | Last modified: | 2023-09-27 | Method: | X-RAY DIFFRACTION (2.3 Å) | Cite: | Factor Inhibiting HIF D201E in Complex with Fe, and Alpha-Ketoglutarate To Be Published
|
|
1PD8
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 1pd8 by Molmil](/molmil-images/mine/1pd8) | Analysis of Three Crystal Structure Determinations of a 5-Methyl-6-N-Methylanilino Pyridopyrimidine Antifolate Complex with Human Dihydrofolate Reductase | Descriptor: | 2,4-DIAMINO-5-METHYL-6-[(3,4,5-TRIMETHOXY-N-METHYLANILINO)METHYL]PYRIDO[2,3-D]PYRIMIDINE, Dihydrofolate reductase, NADPH DIHYDRO-NICOTINAMIDE-ADENINE-DINUCLEOTIDE PHOSPHATE | Authors: | Cody, V, Luft, J.R, Pangborn, W, Gangjee, A. | Deposit date: | 2003-05-19 | Release date: | 2003-12-09 | Last modified: | 2023-08-16 | Method: | X-RAY DIFFRACTION (2.1 Å) | Cite: | Analysis of three crystal structure determinations of a 5-methyl-6-N-methylanilino pyridopyrimidine antifolate complex with human dihydrofolate reductase. Acta Crystallogr.,Sect.D, 59, 2003
|
|
1PDB
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 1pdb by Molmil](/molmil-images/mine/1pdb) | Analysis of Three Crystal Structure Determinations of a 5-Methyl-6-N-Methylanilino Pyridopyrimidine Antifolate Complex with Human Dihydrofolate Reductase | Descriptor: | Dihydrofolate reductase | Authors: | Cody, V, Luft, J.R, Pangborn, W, Gangjee, A. | Deposit date: | 2003-05-19 | Release date: | 2003-12-09 | Last modified: | 2023-08-16 | Method: | X-RAY DIFFRACTION (2.2 Å) | Cite: | Analysis of three crystal structure determinations of a 5-methyl-6-N-methylanilino pyridopyrimidine antifolate complex with human dihydrofolate reductase. Acta Crystallogr.,Sect.D, 59, 2003
|
|
1PD9
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 1pd9 by Molmil](/molmil-images/mine/1pd9) | Analysis of Three Crystal Structure Determinations of a 5-Methyl-6-N-Methylanilino Pyridopyrimidine antifolate Complex with Human Dihydrofolate Reductase | Descriptor: | 2,4-DIAMINO-5-METHYL-6-[(3,4,5-TRIMETHOXY-N-METHYLANILINO)METHYL]PYRIDO[2,3-D]PYRIMIDINE, Dihydrofolate reductase, SULFATE ION | Authors: | Cody, V, Luft, J.R, Pangborn, W, Gangjee, A. | Deposit date: | 2003-05-19 | Release date: | 2003-12-09 | Last modified: | 2023-08-16 | Method: | X-RAY DIFFRACTION (2.2 Å) | Cite: | Analysis of three crystal structure determinations of a 5-methyl-6-N-methylanilino pyridopyrimidine antifolate complex with human dihydrofolate reductase. Acta Crystallogr.,Sect.D, 59, 2003
|
|
8GXS
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 8gxs by Molmil](/molmil-images/mine/8gxs) | PIC-Mediator in complex with +1 nucleosome (T40N) in H-binding state | Descriptor: | CDK-activating kinase assembly factor MAT1, Cyclin-H, Cyclin-dependent kinase 7, ... | Authors: | Chen, X, Wang, X, Liu, W, Ren, Y, Qu, X, Li, J, Yin, X. | Deposit date: | 2022-09-21 | Release date: | 2022-11-02 | Method: | ELECTRON MICROSCOPY (4.16 Å) | Cite: | Structures of +1 nucleosome-bound PIC-Mediator complex. Science, 378, 2022
|
|
8GXQ
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 8gxq by Molmil](/molmil-images/mine/8gxq) | PIC-Mediator in complex with +1 nucleosome (T40N) in MH-binding state | Descriptor: | CDK-activating kinase assembly factor MAT1, Cyclin-H, Cyclin-dependent kinase 7, ... | Authors: | Chen, X, Wang, X, Liu, W, Ren, Y, Qu, X, Li, J, Yin, X, Xu, Y. | Deposit date: | 2022-09-21 | Release date: | 2022-11-02 | Method: | ELECTRON MICROSCOPY (5.04 Å) | Cite: | Structures of +1 nucleosome-bound PIC-Mediator complex. Science, 378, 2022
|
|
2R3A
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 2r3a by Molmil](/molmil-images/mine/2r3a) | Methyltransferase domain of human suppressor of variegation 3-9 homolog 2 | Descriptor: | Histone-lysine N-methyltransferase SUV39H2, S-ADENOSYLMETHIONINE, SERINE, ... | Authors: | Lunin, V.V, Wu, H, Zeng, H, Ren, H, Loppnau, P, Weigelt, J, Sundstrom, M, Arrowsmith, C.H, Edwards, A.M, Bochkarev, A, Plotnikov, A.N, Min, J, Structural Genomics Consortium (SGC) | Deposit date: | 2007-08-29 | Release date: | 2007-09-11 | Last modified: | 2023-08-30 | Method: | X-RAY DIFFRACTION (2 Å) | Cite: | Structural biology of human H3K9 methyltransferases Plos One, 5, 2010
|
|
2QQF
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 2qqf by Molmil](/molmil-images/mine/2qqf) | Hst2 bound to ADP-HPD and Acetylated histone H4 | Descriptor: | 5'-O-[(S)-{[(S)-{[(2R,3R,4S)-3,4-DIHYDROXYPYRROLIDIN-2-YL]METHOXY}(HYDROXY)PHOSPHORYL]OXY}(HYDROXY)PHOSPHORYL]ADENOSINE, Histone H4, NAD-dependent deacetylase HST2, ... | Authors: | Marmorstein, R, Sanders, B.D, Zhao, K, Slama, J. | Deposit date: | 2007-07-26 | Release date: | 2007-10-09 | Last modified: | 2023-11-15 | Method: | X-RAY DIFFRACTION (2 Å) | Cite: | Structural basis for nicotinamide inhibition and base exchange in sir2 enzymes. Mol.Cell, 25, 2007
|
|