2YPF
 
 | | Structure of the AvrBs3-DNA complex provides new insights into the initial thymine-recognition mechanism | | Descriptor: | 5'-D(*TP*AP*GP*AP*GP*GP*GP*TP*TP*AP*GP*GP*TP*TP *TP*AP*TP*AP*TP*AP*AP)-3', 5'-D(*TP*TP*TP*AP*TP*AP*TP*AP*AP*AP*CP*CP*TP*AP *AP*CP*CP*CP*TP*CP*TP*AP)-3', AVRBS3 | | Authors: | Stella, S, Molina, R, Yefimenko, I, Prieto, J, Silva, G.H, Bertonati, C, Juillerat, A, Duchateau, P, Montoya, G. | | Deposit date: | 2012-10-30 | | Release date: | 2013-08-28 | | Last modified: | 2023-12-20 | | Method: | X-RAY DIFFRACTION (2.55 Å) | | Cite: | Structure of the Avrbs3-DNA Complex Provides New Insights Into the Initial Thymine-Recognition Mechanism
Acta Crystallogr.,Sect.D, 69, 2013
|
|
5E3M
 | | Crystal structure of Fis bound to 27bp DNA F35 (AAATTAGTTTGAATCTCGAGCTAATTT) | | Descriptor: | DNA (27-MER), DNA-binding protein Fis | | Authors: | Stella, S, Hancock, S.P, Cascio, D, Johnson, R.C. | | Deposit date: | 2015-10-03 | | Release date: | 2016-03-09 | | Last modified: | 2024-05-22 | | Method: | X-RAY DIFFRACTION (2.886 Å) | | Cite: | DNA Sequence Determinants Controlling Affinity, Stability and Shape of DNA Complexes Bound by the Nucleoid Protein Fis.
Plos One, 11, 2016
|
|
4CJA
 | | BurrH DNA-binding protein from Burkholderia rhizoxinica in complex with its target DNA | | Descriptor: | 5'-D(*DTP*AP*TP*AP*AP*CP*GP*TP*AP*TP*TP*TP*GP*CP *TP*TP*CP*TP*CP*TP*TP*AP*AP)-3', 5'-D(*DTP*TP*AP*AP*GP*AP*GP*AP*AP*GP*CP*AP*AP*DP *TP*AP*CP*GP*TP*TP*AP*TP*AP)-3', BURRH | | Authors: | Stella, S, Molina, R, Lopez-Mendez, B, Campos-Olivas, R, Duchateau, P, Montoya, G. | | Deposit date: | 2013-12-19 | | Release date: | 2014-07-09 | | Last modified: | 2024-05-08 | | Method: | X-RAY DIFFRACTION (2.651 Å) | | Cite: | Bud, a Helix-Loop-Helix DNA-Binding Domain for Genome Modification
Acta Crystallogr.,Sect.D, 70, 2014
|
|
4CJ9
 | | BurrH DNA-binding protein from Burkholderia rhizoxinica in its apo form | | Descriptor: | BURRH, SELENIUM ATOM | | Authors: | Stella, S, Molina, R, Lopez-Mendez, B, Campos-Olivas, R, Duchateau, P, Montoya, G. | | Deposit date: | 2013-12-19 | | Release date: | 2014-07-09 | | Last modified: | 2014-07-23 | | Method: | X-RAY DIFFRACTION (2.214 Å) | | Cite: | Bud, a Helix-Loop-Helix DNA-Binding Domain for Genome Modification
Acta Crystallogr.,Sect.D, 70, 2014
|
|
3IV5
 | |
3JRB
 | |
3JRH
 | |
3JRA
 | |
3JR9
 | |
3JRF
 | |
3JRD
 | |
3JRC
 | |
3JRI
 | |
3JRG
 | |
3JRE
 | |
4UN7
 | | THE CRYSTAL STRUCTURE OF I-DMOI IN COMPLEX WITH ITS TARGET DNA BEFORE INCUBATION IN 5MM MN (STATE 1) | | Descriptor: | 25MER, HOMING ENDONUCLEASE I-DMOI, ZINC ION | | Authors: | Molina, R, Stella, S, Redondo, P, Gomez, H, Marcaida, M.J, Orozco, M, Prieto, J, Montoya, G. | | Deposit date: | 2014-05-26 | | Release date: | 2014-12-03 | | Last modified: | 2024-01-10 | | Method: | X-RAY DIFFRACTION (2.7 Å) | | Cite: | Visualizing Phosphodiester-Bond Hydrolysis by an Endonuclease.
Nat.Struct.Mol.Biol., 22, 2015
|
|
4UNB
 | | THE CRYSTAL STRUCTURE OF I-DMOI IN COMPLEX WITH ITS TARGET DNA AT 6 DAYS INCUBATION IN 5MM MN (STATE 5) | | Descriptor: | 5'-D(*CP*CP*GP*GP*CP*AP*AP*GP*GP*C)-3', 5'-D(*CP*GP*CP*GP*CP*CP*GP*GP*AP*AP*CP*TP*TP*AP*C)-3', 5'-D(*GP*CP*CP*TP*TP*GP*CP*CP*GP*GP*GP*TP*AP*A)-3', ... | | Authors: | Molina, R, Stella, S, Redondo, P, Gomez, H, Marcaida, M.J, Orozco, M, Prieto, J, Montoya, G. | | Deposit date: | 2014-05-26 | | Release date: | 2014-12-17 | | Last modified: | 2024-01-10 | | Method: | X-RAY DIFFRACTION (2.55 Å) | | Cite: | Visualizing Phosphodiester-Bond Hydrolysis by an Endonuclease.
Nat.Struct.Mol.Biol., 22, 2015
|
|
4D6O
 | | THE CRYSTAL STRUCTURE OF I-DMOI IN COMPLEX WITH ITS TARGET DNA AT 1H INCUBATION IN 5MM MG (STATE 2) | | Descriptor: | 25MER, ACETATE ION, HOMING ENDONUCLEASE I-DMOI, ... | | Authors: | Molina, R, Stella, S, Redondo, P, Gomez, H, Marcaida, M.J, Orozco, M, Prieto, J, Montoya, G. | | Deposit date: | 2014-11-13 | | Release date: | 2014-12-17 | | Last modified: | 2023-12-20 | | Method: | X-RAY DIFFRACTION (2.2 Å) | | Cite: | Visualizing Phosphodiester-Bond Hydrolysis by an Endonuclease.
Nat.Struct.Mol.Biol., 22, 2015
|
|
4UT0
 | | THE CRYSTAL STRUCTURE OF I-DMOI IN COMPLEX WITH ITS TARGET DNA AT 10 DAYS INCUBATION IN 5MM MN (STATE 7) | | Descriptor: | 5'-D(*CP*CP*GP*GP*CP*AP*AP*GP*GP*CP)-3', 5'-D(*CP*GP*CP*GP*CP*CP*GP*GP*AP*AP*CP*TP*TP*AP*CP)-3', 5'-D(*GP*CP*CP*TP*TP*GP*CP*CP*GP*GP*GP*TP*AP*AP)-3', ... | | Authors: | Molina, R, Stella, S, Redondo, P, Gomez, H, Marcaida, M.J, Orozco, M, Prieto, J, Montoya, G. | | Deposit date: | 2014-07-17 | | Release date: | 2014-12-17 | | Last modified: | 2024-01-10 | | Method: | X-RAY DIFFRACTION (2.4 Å) | | Cite: | Visualizing Phosphodiester-Bond Hydrolysis by an Endonuclease.
Nat.Struct.Mol.Biol., 22, 2015
|
|
5MGA
 | |
7ODF
 | | Structure of the mini-RNA-guided endonuclease CRISPR-Cas_phi3 | | Descriptor: | Cas_phi3, DNA (5'-D(P*GP*G)-3'), DNA (5'-D(P*GP*TP*AP*AP*TP*TP*CP*AP*G)-3'), ... | | Authors: | Carabias del Rey, A, Fugilsang, A, Temperini, P, Pape, T, Sofos, N, Stella, S, Erledsson, S, Montoya, G. | | Deposit date: | 2021-04-29 | | Release date: | 2021-07-21 | | Last modified: | 2024-07-10 | | Method: | ELECTRON MICROSCOPY (2.66 Å) | | Cite: | Structure of the mini-RNA-guided endonuclease CRISPR-Cas12j3.
Nat Commun, 12, 2021
|
|
4D6N
 | | THE CRYSTAL STRUCTURE OF I-DMOI IN COMPLEX WITH ITS TARGET DNA AT 10 DAYS INCUBATION IN 5MM MG (STATE 7) | | Descriptor: | 5'-D(*DCP*CP*GP*GP*CP*AP*AP*GP*GP*CP)-3', 5'-D(*DCP*GP*CP*GP*CP*CP*GP*GP*AP*AP*CP*TP*TP*DAP*C)-3', 5'-D(*DGP*CP*CP*TP*TP*GP*CP*CP*GP*GP*GP*TP*AP*DAP)-3', ... | | Authors: | Molina, R, Stella, S, Redondo, P, Gomez, H, Marcaida, M.J, Orozco, M, Prieto, J, Montoya, G. | | Deposit date: | 2014-11-13 | | Release date: | 2014-12-17 | | Last modified: | 2023-12-20 | | Method: | X-RAY DIFFRACTION (2.35 Å) | | Cite: | Visualizing Phosphodiester-Bond Hydrolysis by an Endonuclease.
Nat.Struct.Mol.Biol., 22, 2015
|
|
6SIC
 | | Cryo-EM structure of the Type III-B Cmr-beta bound to cognate target RNA | | Descriptor: | CRISPR-associated RAMP protein, Cmr1 family, Cmr4 family, ... | | Authors: | Sofos, N, Montoya, G, Stella, S. | | Deposit date: | 2019-08-09 | | Release date: | 2020-07-08 | | Last modified: | 2020-09-16 | | Method: | ELECTRON MICROSCOPY (3.52 Å) | | Cite: | Structures of the Cmr-beta Complex Reveal the Regulation of the Immunity Mechanism of Type III-B CRISPR-Cas.
Mol.Cell, 79, 2020
|
|
6S8E
 | | Cryo-EM structure of the type III-B Cmr-beta complex bound to non-cognate target RNA | | Descriptor: | CRISPR-associated RAMP protein, Cmr4 family, Cmr6 family, ... | | Authors: | Sofos, N, Montoya, G, Stella, S. | | Deposit date: | 2019-07-09 | | Release date: | 2020-07-08 | | Last modified: | 2020-09-16 | | Method: | ELECTRON MICROSCOPY (3.1 Å) | | Cite: | Structures of the Cmr-beta Complex Reveal the Regulation of the Immunity Mechanism of Type III-B CRISPR-Cas.
Mol.Cell, 79, 2020
|
|
6SH8
 | | Cryo-EM structure of the Type III-B Cmr-beta bound to cognate target RNA and AMPPnP, state 2, in the presence of ssDNA | | Descriptor: | CRISPR-associated RAMP protein, Cmr4 family, Cmr6 family, ... | | Authors: | Sofos, N, Montoya, G, Stella, S. | | Deposit date: | 2019-08-06 | | Release date: | 2020-07-08 | | Last modified: | 2020-09-16 | | Method: | ELECTRON MICROSCOPY (3.14 Å) | | Cite: | Structures of the Cmr-beta Complex Reveal the Regulation of the Immunity Mechanism of Type III-B CRISPR-Cas.
Mol.Cell, 79, 2020
|
|
