5FXY
 
 | | Structure of the human RBBP4:MTA1(464-546) complex | | Descriptor: | HISTONE-BINDING PROTEIN RBBP4, METASTASIS-ASSOCIATED PROTEIN MTA1 | | Authors: | Millard, C.J, Varma, N, Fairall, L, Schwabe, J.W.R. | | Deposit date: | 2016-03-03 | | Release date: | 2016-05-18 | | Last modified: | 2024-01-10 | | Method: | X-RAY DIFFRACTION (3.2 Å) | | Cite: | The structure of the core NuRD repression complex provides insights into its interaction with chromatin.
Elife, 5, 2016
|
|
5E7Z
 | | 3-deoxy-D-arabino-heptulosonate 7-phosphate synthase from Mycobacterium tuberculosis in complex with D/L-tryptophan and D-phenylalanine | | Descriptor: | 3-deoxy-D-arabinoheptulosonate-7-phosphate synthase, D-PHENYLALANINE, D-TRYPTOPHAN, ... | | Authors: | Reichau, S, Jiao, W, Parker, E.J. | | Deposit date: | 2015-10-13 | | Release date: | 2016-06-01 | | Last modified: | 2023-11-15 | | Method: | X-RAY DIFFRACTION (2.4 Å) | | Cite: | Probing the Sophisticated Synergistic Allosteric Regulation of Aromatic Amino Acid Biosynthesis in Mycobacterium tuberculosis Using -Amino Acids.
Plos One, 11, 2016
|
|
8CUF
 | | Synthetic epi-Novo29 (2R,3S), X-ray diffractometer structure | | Descriptor: | ACETATE ION, IODIDE ION, Synthetic epi-Novo29 (2R,3S) | | Authors: | Kreutzer, A.G, Li, X, Krumberger, M, Nowick, J.S. | | Deposit date: | 2022-05-17 | | Release date: | 2023-01-11 | | Last modified: | 2023-11-15 | | Method: | X-RAY DIFFRACTION (1.68 Å) | | Cite: | Synthesis and Stereochemical Determination of the Peptide Antibiotic Novo29.
J.Org.Chem., 88, 2023
|
|
8CUG
 | | Synthetic epi-Novo29 (2R,3S), synchrotron structure | | Descriptor: | ACETATE ION, Synthetic epi-Novo29 (2R,3S) | | Authors: | Kreutzer, A.G, Li, X, Krumberger, M, Nowick, J.S. | | Deposit date: | 2022-05-17 | | Release date: | 2023-01-11 | | Last modified: | 2023-11-15 | | Method: | X-RAY DIFFRACTION (1.131 Å) | | Cite: | Synthesis and Stereochemical Determination of the Peptide Antibiotic Novo29.
J.Org.Chem., 88, 2023
|
|
5LI9
 | | Structure of a nucleotide-bound form of PKCiota core kinase domain | | Descriptor: | (4R)-2-METHYLPENTANE-2,4-DIOL, ACETATE ION, DI(HYDROXYETHYL)ETHER, ... | | Authors: | Ivanova, M.E, Purkiss, A.G, McDonald, N.Q. | | Deposit date: | 2016-07-14 | | Release date: | 2016-09-14 | | Last modified: | 2024-01-10 | | Method: | X-RAY DIFFRACTION (1.79 Å) | | Cite: | aPKC Inhibition by Par3 CR3 Flanking Regions Controls Substrate Access and Underpins Apical-Junctional Polarization.
Dev.Cell, 38, 2016
|
|
5E3M
 | | Crystal structure of Fis bound to 27bp DNA F35 (AAATTAGTTTGAATCTCGAGCTAATTT) | | Descriptor: | DNA (27-MER), DNA-binding protein Fis | | Authors: | Stella, S, Hancock, S.P, Cascio, D, Johnson, R.C. | | Deposit date: | 2015-10-03 | | Release date: | 2016-03-09 | | Last modified: | 2024-05-22 | | Method: | X-RAY DIFFRACTION (2.886 Å) | | Cite: | DNA Sequence Determinants Controlling Affinity, Stability and Shape of DNA Complexes Bound by the Nucleoid Protein Fis.
Plos One, 11, 2016
|
|
5LRN
 | | Structure of mono-zinc MCR-1 in P21 space group | | Descriptor: | GLYCEROL, Phosphatidylethanolamine transferase Mcr-1, ZINC ION | | Authors: | Hinchliffe, P, Paterson, N.G, Spencer, J. | | Deposit date: | 2016-08-19 | | Release date: | 2016-12-07 | | Last modified: | 2024-01-17 | | Method: | X-RAY DIFFRACTION (1.55 Å) | | Cite: | Insights into the Mechanistic Basis of Plasmid-Mediated Colistin Resistance from Crystal Structures of the Catalytic Domain of MCR-1.
Sci Rep, 7, 2017
|
|
5E8P
 | | The structure of the TEIPP associated altered peptide ligand Trh4-p5NLE in complex with H-2D(b) | | Descriptor: | Beta-2-microglobulin, Ceramide synthase 5, H-2 class I histocompatibility antigen, ... | | Authors: | Hafstrand, I, Doorduijn, E, Duru, A.D, Buratto, J, Oliveira, C.C, Sandalova, T, van Hall, T, Achour, A. | | Deposit date: | 2015-10-14 | | Release date: | 2016-02-03 | | Last modified: | 2024-01-10 | | Method: | X-RAY DIFFRACTION (2 Å) | | Cite: | The MHC Class I Cancer-Associated Neoepitope Trh4 Linked with Impaired Peptide Processing Induces a Unique Noncanonical TCR Conformer.
J Immunol., 196, 2016
|
|
6NBU
 | |
7Q91
 | | Crystal Structure of Agrobacterium tumefaciens NADQ, native form. | | Descriptor: | NADQ transcription factor, SODIUM ION | | Authors: | Cianci, M, Minazzato, G, Heroux, A, Raffaelli, N, Sorci, L, Gasparrini, M. | | Deposit date: | 2021-11-11 | | Release date: | 2022-11-09 | | Last modified: | 2024-06-19 | | Method: | X-RAY DIFFRACTION (2.31 Å) | | Cite: | Bacterial NadQ (COG4111) is a Nudix-like, ATP-responsive regulator of NAD biosynthesis.
J.Struct.Biol., 214, 2022
|
|
5E40
 | | 3-Deoxy-D-arabino-heptulosonate 7-phosphate synthase from Mycobacterium tuberculosis with D-tyrosine bound in the phenylalanine binding site | | Descriptor: | 3-deoxy-D-arabinoheptulosonate-7-phosphate synthase, D-TYROSINE, GLYCEROL, ... | | Authors: | Reichau, S, Jiao, W, Parker, E.J. | | Deposit date: | 2015-10-05 | | Release date: | 2016-06-01 | | Last modified: | 2023-09-27 | | Method: | X-RAY DIFFRACTION (2.05 Å) | | Cite: | Probing the Sophisticated Synergistic Allosteric Regulation of Aromatic Amino Acid Biosynthesis in Mycobacterium tuberculosis Using -Amino Acids.
Plos One, 11, 2016
|
|
5VOP
 | | Methionine synthase folate-binding domain from Thermus thermophilus HB8 native | | Descriptor: | 5-METHYL-5,6,7,8-TETRAHYDROFOLIC ACID, 5-methyltetrahydrofolate homocysteine S-methyltransferase, CITRATE ANION, ... | | Authors: | Koutmos, M, Yamada, K. | | Deposit date: | 2017-05-03 | | Release date: | 2018-01-17 | | Last modified: | 2023-10-04 | | Method: | X-RAY DIFFRACTION (2.1 Å) | | Cite: | The folate-binding module of Thermus thermophilus cobalamin-dependent methionine synthase displays a distinct variation of the classical TIM barrel: a TIM barrel with a `twist'.
Acta Crystallogr D Struct Biol, 74, 2018
|
|
5E92
 | | TGF-BETA RECEPTOR TYPE 2 KINASE DOMAIN (E431A,R433A,E485A,K488A,R493A,R495A) IN COMPLEX WITH AMPPNP | | Descriptor: | MAGNESIUM ION, PHOSPHOAMINOPHOSPHONIC ACID-ADENYLATE ESTER, TGF-beta receptor type-2 | | Authors: | Sheriff, S. | | Deposit date: | 2015-10-14 | | Release date: | 2016-05-11 | | Last modified: | 2023-09-27 | | Method: | X-RAY DIFFRACTION (2.08 Å) | | Cite: | Crystal structures of apo and inhibitor-bound TGF beta R2 kinase domain: insights into TGF beta R isoform selectivity.
Acta Crystallogr D Struct Biol, 72, 2016
|
|
7UYI
 | |
5LJA
 | | Structure of the E. coli MacB ABC domain (P6122) | | Descriptor: | Macrolide export ATP-binding/permease protein MacB | | Authors: | Crow, A. | | Deposit date: | 2016-07-18 | | Release date: | 2017-11-15 | | Last modified: | 2024-01-10 | | Method: | X-RAY DIFFRACTION (2.4 Å) | | Cite: | Structure and mechanotransmission mechanism of the MacB ABC transporter superfamily.
Proc. Natl. Acad. Sci. U.S.A., 114, 2017
|
|
5EA4
 | | Crystal Structure of Inhibitor JNJ-49153390 in Complex with Prefusion RSV F Glycoprotein | | Descriptor: | 2-[N-CYCLOHEXYLAMINO]ETHANE SULFONIC ACID, 3-[[5-bromanyl-1-(3-methylsulfonylpropyl)benzimidazol-2-yl]methyl]-1-cyclopropyl-imidazo[4,5-c]pyridin-2-one, Fusion glycoprotein F0, ... | | Authors: | Battles, M.B, McLellan, J.S, Arnoult, E, Roymans, D, Langedijk, J.P. | | Deposit date: | 2015-10-15 | | Release date: | 2015-12-09 | | Last modified: | 2023-09-27 | | Method: | X-RAY DIFFRACTION (2.3 Å) | | Cite: | Molecular mechanism of respiratory syncytial virus fusion inhibitors.
Nat.Chem.Biol., 12, 2016
|
|
5EAF
 | | Saccharomyces cerevisiae CYP51 complexed with the plant pathogen inhibitor Fluquinconazole | | Descriptor: | 3-(2,4-dichlorophenyl)-6-fluoranyl-2-(1,2,4-triazol-1-yl)quinazolin-4-one, Lanosterol 14-alpha demethylase, PROTOPORPHYRIN IX CONTAINING FE | | Authors: | Tyndall, J.D.A, Sabherwal, M, Sagatova, A.A, Keniya, M.V, Wilson, R.K, Woods, M.V, Monk, B.C. | | Deposit date: | 2015-10-16 | | Release date: | 2016-02-10 | | Last modified: | 2023-09-27 | | Method: | X-RAY DIFFRACTION (2.65 Å) | | Cite: | Structural and Functional Elucidation of Yeast Lanosterol 14 alpha-Demethylase in Complex with Agrochemical Antifungals.
PLoS ONE, 11, 2016
|
|
6NCY
 | | Crystal structure of hybrid beta-glucuronidase/beta-galacturonidase from Fusicatenibacter saccharivorans | | Descriptor: | Beta-glucuronidase, GLYCEROL, NICKEL (II) ION, ... | | Authors: | Walton, W.G, Pellock, S.J, Redinbo, M.R. | | Deposit date: | 2018-12-12 | | Release date: | 2019-02-20 | | Last modified: | 2024-03-13 | | Method: | X-RAY DIFFRACTION (2.05 Å) | | Cite: | Selecting a Single Stereocenter: The Molecular Nuances That Differentiate beta-Hexuronidases in the Human Gut Microbiome.
Biochemistry, 58, 2019
|
|
5LJN
 | | Structure of the HOIP PUB domain bound to SPATA2 PIM peptide | | Descriptor: | E3 ubiquitin-protein ligase RNF31, GLYCEROL, SULFATE ION, ... | | Authors: | Elliott, P.R, Komander, D. | | Deposit date: | 2016-07-18 | | Release date: | 2016-08-24 | | Last modified: | 2024-01-10 | | Method: | X-RAY DIFFRACTION (2.701 Å) | | Cite: | SPATA2 Links CYLD to LUBAC, Activates CYLD, and Controls LUBAC Signaling.
Mol.Cell, 63, 2016
|
|
5LSC
 | | The structure of the metallo-beta-lactamase VIM-2 in complex with a triazolylthioacetamide inhibitor | | Descriptor: | 2-[5-[2-(1,3-benzothiazol-2-ylamino)-2-oxidanylidene-ethyl]sulfanyl-4~{H}-1,2,4-triazol-3-yl]benzoic acid, CHLORIDE ION, Metallo-beta-lactamase VIM-2-like protein, ... | | Authors: | Christopeit, T, Yang, K.-W, Yang, S.-K, Leiros, H.-K.S. | | Deposit date: | 2016-08-25 | | Release date: | 2016-11-09 | | Last modified: | 2024-01-17 | | Method: | X-RAY DIFFRACTION (1.497 Å) | | Cite: | The structure of the metallo-beta-lactamase VIM-2 in complex with a triazolylthioacetamide inhibitor.
Acta Crystallogr F Struct Biol Commun, 72, 2016
|
|
8D47
 | |
5LJY
 | | Structure of hantavirus envelope glycoprotein Gc in complex with scFv A5 | | Descriptor: | 2-acetamido-2-deoxy-beta-D-glucopyranose, COBALT HEXAMMINE(III), Envelopment polyprotein, ... | | Authors: | Guardado-Calvo, P, Stettner, E, Jeffers, S.A, Rey, F.A. | | Deposit date: | 2016-07-20 | | Release date: | 2016-09-14 | | Last modified: | 2020-07-29 | | Method: | X-RAY DIFFRACTION (3 Å) | | Cite: | Mechanistic Insight into Bunyavirus-Induced Membrane Fusion from Structure-Function Analyses of the Hantavirus Envelope Glycoprotein Gc.
Plos Pathog., 12, 2016
|
|
8D39
 | |
5LSR
 | | Carboxysome shell protein CcmP from Synechococcus elongatus PCC 7942 | | Descriptor: | CcmP, THIOCYANATE ION | | Authors: | Larsson, A.M, Hasse, D, Valegard, K, Andersson, I. | | Deposit date: | 2016-09-05 | | Release date: | 2017-04-12 | | Last modified: | 2024-01-17 | | Method: | X-RAY DIFFRACTION (1.65 Å) | | Cite: | Crystal structures of beta-carboxysome shell protein CcmP: ligand binding correlates with the closed or open central pore.
J. Exp. Bot., 68, 2017
|
|
6NM0
 | | Selective inhibition of carbonic anhydrase IX activity, using compound SLC-149, displays limited anticancer effects in breast cancer cell lines | | Descriptor: | 4-[3-(2,4-difluorophenyl)-2-oxo-2,3-dihydro-1H-imidazol-1-yl]benzene-1-sulfonamide, Carbonic anhydrase 2, DIMETHYL SULFOXIDE, ... | | Authors: | Singh, S, McKenna, R. | | Deposit date: | 2019-01-10 | | Release date: | 2020-01-15 | | Last modified: | 2023-10-11 | | Method: | X-RAY DIFFRACTION (1.44 Å) | | Cite: | Inhibition of Carbonic Anhydrase Using SLC-149: Support for a Noncatalytic Function of CAIX in Breast Cancer.
J.Med.Chem., 64, 2021
|
|
