4KSQ
| Crystal Structure of Human B-raf bound to a DFG-out Inhibitor 5B | Descriptor: | N-{7-cyano-6-[4-fluoro-3-({[3-(trifluoromethyl)phenyl]carbamoyl}amino)phenoxy]-1,3-benzothiazol-2-yl}cyclopropanecarboxamide, Serine/threonine-protein kinase B-raf | Authors: | Yano, J.K, Masanori, O. | Deposit date: | 2013-05-17 | Release date: | 2013-07-24 | Last modified: | 2024-02-28 | Method: | X-RAY DIFFRACTION (3.3 Å) | Cite: | Discovery of a Selective Kinase Inhibitor (TAK-632) Targeting Pan-RAF Inhibition: Design, Synthesis, and Biological Evaluation of C-7-Substituted 1,3-Benzothiazole Derivatives. J.Med.Chem., 56, 2013
|
|
2RF8
| |
3E20
| Crystal structure of S.pombe eRF1/eRF3 complex | Descriptor: | Eukaryotic peptide chain release factor GTP-binding subunit, Eukaryotic peptide chain release factor subunit 1 | Authors: | Cheng, Z, Lim, M, Kong, C, Song, H. | Deposit date: | 2008-08-05 | Release date: | 2009-05-19 | Last modified: | 2023-11-01 | Method: | X-RAY DIFFRACTION (3.5 Å) | Cite: | Structural insights into eRF3 and stop codon recognition by eRF1 Genes Dev., 23, 2009
|
|
4KT7
| The crystal structure of 4-diphosphocytidyl-2C-methyl-D-erythritolsynthase from Anaerococcus prevotii DSM 20548 | Descriptor: | 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase, CHLORIDE ION, SODIUM ION | Authors: | Borek, D, Tan, K, Stols, L, Eschenfeidt, W.H, Otwinoski, Z, Joachimiak, A, Midwest Center for Structural Genomics (MCSG) | Deposit date: | 2013-05-20 | Release date: | 2013-06-05 | Last modified: | 2019-07-17 | Method: | X-RAY DIFFRACTION (2.001 Å) | Cite: | The crystal structure of 4-diphosphocytidyl-2C-methyl-D-erythritolsynthase from Anaerococcus prevotii DSM 20548 To be Published
|
|
8TDP
| Time-resolved SFX-XFEL crystal structure of CYP121 bound with cYY reacted with peracetic acid for 200 milliseconds | Descriptor: | (3S,6S)-3,6-bis(4-hydroxybenzyl)piperazine-2,5-dione, HYDROGEN PEROXIDE, Mycocyclosin synthase, ... | Authors: | Nguyen, R.C, Dasgupta, M, Bhowmick, A, Kern, J.F, Liu, A. | Deposit date: | 2023-07-04 | Release date: | 2023-11-22 | Last modified: | 2023-12-06 | Method: | X-RAY DIFFRACTION (1.85 Å) | Cite: | In Situ Structural Observation of a Substrate- and Peroxide-Bound High-Spin Ferric-Hydroperoxo Intermediate in the P450 Enzyme CYP121. J.Am.Chem.Soc., 145, 2023
|
|
4KQE
| The mutant structure of the human glycyl-tRNA synthetase E71G | Descriptor: | GLYCEROL, Glycine--tRNA ligase | Authors: | Qin, X, Hao, Z, Tian, Q, Zhang, Z, Zhou, C, Xie, W. | Deposit date: | 2013-05-15 | Release date: | 2014-05-21 | Last modified: | 2023-11-08 | Method: | X-RAY DIFFRACTION (2.739 Å) | Cite: | Large Conformational Changes of Insertion 3 in Human Glycyl-tRNA Synthetase (hGlyRS) during Catalysis J.Biol.Chem., 291, 2016
|
|
5E3M
| Crystal structure of Fis bound to 27bp DNA F35 (AAATTAGTTTGAATCTCGAGCTAATTT) | Descriptor: | DNA (27-MER), DNA-binding protein Fis | Authors: | Stella, S, Hancock, S.P, Cascio, D, Johnson, R.C. | Deposit date: | 2015-10-03 | Release date: | 2016-03-09 | Last modified: | 2024-05-22 | Method: | X-RAY DIFFRACTION (2.886 Å) | Cite: | DNA Sequence Determinants Controlling Affinity, Stability and Shape of DNA Complexes Bound by the Nucleoid Protein Fis. Plos One, 11, 2016
|
|
7Q06
| Crystal structure of TPADO in complex with 2-OH-TPA | Descriptor: | 2-Hydroxyterephthalic acid, FE (III) ION, FE2/S2 (INORGANIC) CLUSTER, ... | Authors: | Zahn, M, Kincannon, W.M, DuBois, J.L, McGeehan, J.E. | Deposit date: | 2021-10-14 | Release date: | 2022-03-30 | Last modified: | 2024-01-31 | Method: | X-RAY DIFFRACTION (1.95 Å) | Cite: | Biochemical and structural characterization of an aromatic ring-hydroxylating dioxygenase for terephthalic acid catabolism. Proc.Natl.Acad.Sci.USA, 119, 2022
|
|
8TVR
| |
4KTJ
| |
7Q05
| Crystal structure of TPADO in complex with TPA | Descriptor: | FE (III) ION, FE2/S2 (INORGANIC) CLUSTER, Lysozyme, ... | Authors: | Zahn, M, Kincannon, W.M, DuBois, J.L, McGeehan, J.E. | Deposit date: | 2021-10-14 | Release date: | 2022-03-30 | Last modified: | 2024-01-31 | Method: | X-RAY DIFFRACTION (2.08 Å) | Cite: | Biochemical and structural characterization of an aromatic ring-hydroxylating dioxygenase for terephthalic acid catabolism. Proc.Natl.Acad.Sci.USA, 119, 2022
|
|
4KTO
| Crystal Structure Of a Putative Isovaleryl-CoA dehydrogenase (PSI-NYSGRC-012251) from Sinorhizobium meliloti 1021 | Descriptor: | 2-AMINO-2-HYDROXYMETHYL-PROPANE-1,3-DIOL, FLAVIN-ADENINE DINUCLEOTIDE, isovaleryl-CoA dehydrogenase | Authors: | Kumar, P.R, Ahmed, M, Attonito, J, Bhosle, R, Bonanno, J, Chamala, S, Chowdhury, S, Glenn, A.S, Hammonds, J, Hillerich, B, Himmel, D, Love, J.D, Seidel, R, Stead, M, Toro, R, Wasserman, S.R, Almo, S.C, New York Structural Genomics Research Consortium (NYSGRC) | Deposit date: | 2013-05-20 | Release date: | 2013-06-19 | Last modified: | 2023-12-06 | Method: | X-RAY DIFFRACTION (2.137 Å) | Cite: | Crystal structure of a Putative Isovaleryl-CoA dehydrogenase from Sinorhizobium meliloti 1021 to be published
|
|
7PH1
| Trypsin in complex with BPTI mutant (2S)-2-amino-4-monofluorobutanoic acid | Descriptor: | CALCIUM ION, Cationic trypsin, GLYCEROL, ... | Authors: | Dimos, N, Leppkes, J, Koksch, B, Loll, B. | Deposit date: | 2021-08-16 | Release date: | 2022-03-30 | Last modified: | 2024-01-31 | Method: | X-RAY DIFFRACTION (1.18 Å) | Cite: | Water Network in the Binding Pocket of Fluorinated BPTI-Trypsin Complexes─Insights from Simulation and Experiment. J.Phys.Chem.B, 126, 2022
|
|
4K5H
| Structure of bovine endothelial nitric oxide synthase heme domain in complex with (S)-1,2-bis((2-amino-4-methylpyridin-6-yl)-methoxy)-propan-3-amine | Descriptor: | 5,6,7,8-TETRAHYDROBIOPTERIN, 6,6'-{[(2S)-3-aminopropane-1,2-diyl]bis(oxymethanediyl)}bis(4-methylpyridin-2-amine), ACETATE ION, ... | Authors: | Chreifi, G, Li, H, Poulos, T.L. | Deposit date: | 2013-04-14 | Release date: | 2013-09-18 | Last modified: | 2023-09-20 | Method: | X-RAY DIFFRACTION (2.25 Å) | Cite: | Chiral linkers to improve selectivity of double-headed neuronal nitric oxide synthase inhibitors. Bioorg.Med.Chem.Lett., 23, 2013
|
|
2DHR
| Whole cytosolic region of ATP-dependent metalloprotease FtsH (G399L) | Descriptor: | ADENOSINE-5'-DIPHOSPHATE, FtsH | Authors: | Suno, R, Niwa, H, Tsuchiya, D, Zhang, X, Yoshida, M, Morikawa, K. | Deposit date: | 2006-03-24 | Release date: | 2006-06-27 | Last modified: | 2024-05-29 | Method: | X-RAY DIFFRACTION (3.9 Å) | Cite: | Structure of the Whole Cytosolic Region of ATP-Dependent Protease FtsH Mol.Cell, 22, 2006
|
|
4KTF
| Crystal structure of Mycobacterium tuberculosis CYP121 in complex with 4,4'-(3-amino-1H-pyrazole-4,5-diyl)diphenol | Descriptor: | 4,4'-(3-amino-1H-pyrazole-4,5-diyl)diphenol, Cytochrome P450 121, PROTOPORPHYRIN IX CONTAINING FE, ... | Authors: | Hudson, S.A. | Deposit date: | 2013-05-20 | Release date: | 2013-07-03 | Last modified: | 2023-09-20 | Method: | X-RAY DIFFRACTION (1.35 Å) | Cite: | Overcoming the Limitations of Fragment Merging: Rescuing a Strained Merged Fragment Series Targeting Mycobacterium tuberculosis CYP121. Chemmedchem, 8, 2013
|
|
7PXP
| Benzoylsuccinyl-CoA thiolase | Descriptor: | Benzoylsuccinyl-CoA thiolase subunit, ZINC ION | Authors: | Ermler, U, Heider, H, Weidenweber, S, Demmer, U. | Deposit date: | 2021-10-08 | Release date: | 2022-04-06 | Last modified: | 2024-06-19 | Method: | X-RAY DIFFRACTION (2 Å) | Cite: | Finis tolueni: a new type of thiolase with an integrated Zn-finger subunit catalyzes the final step of anaerobic toluene metabolism. Febs J., 289, 2022
|
|
2RIR
| Crystal structure of dipicolinate synthase, A chain, from Bacillus subtilis | Descriptor: | CHLORIDE ION, Dipicolinate synthase, A chain, ... | Authors: | Osipiuk, J, Quartey, P, Moy, S, Joachimiak, A, Midwest Center for Structural Genomics (MCSG) | Deposit date: | 2007-10-12 | Release date: | 2007-10-23 | Last modified: | 2017-10-25 | Method: | X-RAY DIFFRACTION (2.79 Å) | Cite: | Crystal structure of dipicolinate synthase, A chain, from Bacillus subtilis. To be Published
|
|
4FZB
| Structure of thymidylate synthase ThyX complexed to a new inhibitor | Descriptor: | 2-hydroxy-3-(4-methoxybenzyl)naphthalene-1,4-dione, DIMETHYL SULFOXIDE, FLAVIN-ADENINE DINUCLEOTIDE, ... | Authors: | Basta, T, Boum, Y, Briffotaux, J, Becker, H.F, Lamarre-Jouenne, I, Lambry, J.C, Skouloubris, S, Liebl, U, van Tilbeurgh, H, Graille, M, Myllylkallio, H. | Deposit date: | 2012-07-06 | Release date: | 2013-05-22 | Last modified: | 2023-09-13 | Method: | X-RAY DIFFRACTION (2.59 Å) | Cite: | Mechanistic and structural basis for inhibition of thymidylate synthase ThyX. Open Biology, 2, 2012
|
|
5BRT
| Crystal Structure of 2-hydroxybiphenyl 3-monooxygenase from Pseudomonas azelaica with 2-hydroxybiphenyl in the active site | Descriptor: | 2-HYDROXYBIPHENYL, 2-hydroxybiphenyl-3-monooxygenase, FLAVIN-ADENINE DINUCLEOTIDE | Authors: | Kanteev, M, Bregman-Cohen, A, Deri, B, Adir, N, Fishman, A. | Deposit date: | 2015-06-01 | Release date: | 2015-08-19 | Last modified: | 2024-01-10 | Method: | X-RAY DIFFRACTION (2.3 Å) | Cite: | A crystal structure of 2-hydroxybiphenyl 3-monooxygenase with bound substrate provides insights into the enzymatic mechanism. Biochim.Biophys.Acta, 1854, 2015
|
|
2ZQJ
| Substrate-Free Form of Cytochrome P450BSbeta | Descriptor: | Cytochrome P450 152A1, PROTOPORPHYRIN IX CONTAINING FE | Authors: | Shoji, O, Fujishiro, T, Nagano, S, Hirose, T, Shiro, Y, Watanabe, Y. | Deposit date: | 2008-08-11 | Release date: | 2009-09-01 | Last modified: | 2023-11-01 | Method: | X-RAY DIFFRACTION (2.9 Å) | Cite: | Understanding substrate misrecognition of hydrogen peroxide dependent cytochrome P450 from Bacillus subtilis. J.Biol.Inorg.Chem., 2010
|
|
7PVJ
| Crystal structure of Thioredoxin Reductase from Brugia Malayi in complex with auranofin | Descriptor: | (4S)-2-METHYL-2,4-PENTANEDIOL, 2'-MONOPHOSPHOADENOSINE-5'-DIPHOSPHATE, FLAVIN-ADENINE DINUCLEOTIDE, ... | Authors: | Fata, F, Ardini, M, Silvestri, I, Gabriele, F, Ippoliti, R, Gencheva, R, Cheng, Q, Arner, E.S.J, Angelucci, F, Williams, D.L. | Deposit date: | 2021-10-04 | Release date: | 2022-04-06 | Last modified: | 2024-01-31 | Method: | X-RAY DIFFRACTION (3.1 Å) | Cite: | Biochemical and structural characterizations of thioredoxin reductase selenoproteins of the parasitic filarial nematodes Brugia malayi and Onchocerca volvulus. Redox Biol, 51, 2022
|
|
5BSF
| Crystal structure of Medicago truncatula (delta)1-Pyrroline-5-Carboxylate Reductase (MtP5CR) in complex with NAD+ | Descriptor: | 3[N-MORPHOLINO]PROPANE SULFONIC ACID, CHLORIDE ION, NICOTINAMIDE-ADENINE-DINUCLEOTIDE, ... | Authors: | Ruszkowski, M, Nocek, B, Forlani, G, Dauter, Z. | Deposit date: | 2015-06-02 | Release date: | 2015-11-11 | Last modified: | 2023-09-27 | Method: | X-RAY DIFFRACTION (1.85 Å) | Cite: | The structure of Medicago truncatula delta (1)-pyrroline-5-carboxylate reductase provides new insights into regulation of proline biosynthesis in plants. Front Plant Sci, 6, 2015
|
|
4KL4
| Crystal structure of Ribosome inactivating protein from Momordica balsamina complexed with Polyethylene glycol at 1.90 Angstrom resolution | Descriptor: | 2-acetamido-2-deoxy-beta-D-glucopyranose, DI(HYDROXYETHYL)ETHER, GLYCEROL, ... | Authors: | Pandey, S, Tyagi, T.K, Singh, A, Bhushan, A, Kushwaha, G.S, Sinha, M, Kaur, P, Sharma, S, Singh, T.P. | Deposit date: | 2013-05-07 | Release date: | 2013-05-22 | Last modified: | 2023-11-08 | Method: | X-RAY DIFFRACTION (1.9 Å) | Cite: | Crystal structure of Ribosome inactivating protein from Momordica balsamina complexed with Polyethylene glycol at 1.90 Angstrom resolution To be Published
|
|
2RLC
| |