6W4L
 
 | | The crystal structure of a single chain H2B-H2A histone chimera from Xenopus laevis | | Descriptor: | Histone H2B 1.1,Histone H2A type 1, PYROPHOSPHATE | | Authors: | Warren, C, Bonanno, J.B, Almo, S.C, Shechter, D. | | Deposit date: | 2020-03-11 | | Release date: | 2020-05-06 | | Last modified: | 2023-10-18 | | Method: | X-RAY DIFFRACTION (1.31 Å) | | Cite: | Structure of a single-chain H2A/H2B dimer.
Acta Crystallogr.,Sect.F, 76, 2020
|
|
1KX5
 | | X-Ray Structure of the Nucleosome Core Particle, NCP147, at 1.9 A Resolution | | Descriptor: | CHLORIDE ION, DNA (5'(ATCAATATCCACCTGCAGATACTACCAAAAGTGTATTTGGAAACTGCTCCATCAAAAGGCATGTTCAGCTGGAATCCAGCTGAACATGCCTTTTGATGGAGCAGTTTCCAAATACACTTTTGGTAGTATCTGCAGGTGGATATTGAT)3'), DNA (5'(ATCAATATCCACCTGCAGATACTACCAAAAGTGTATTTGGAAACTGCTCCATCAAAAGGCATGTTCAGCTGGATTCCAGCTGAACATGCCTTTTGATGGAGCAGTTTCCAAATACACTTTTGGTAGTATCTGCAGGTGGATATTGAT)3'), ... | | Authors: | Davey, C.A, Sargent, D.F, Luger, K, Maeder, A.W, Richmond, T.J. | | Deposit date: | 2002-01-31 | | Release date: | 2002-12-25 | | Last modified: | 2023-08-16 | | Method: | X-RAY DIFFRACTION (1.94 Å) | | Cite: | Solvent Mediated Interactions in the Structure of the Nucleosome Core Particle at 1.9 A Resolution
J.Mol.Biol., 319, 2002
|
|
1KX3
 | | X-Ray Structure of the Nucleosome Core Particle, NCP146, at 2.0 A Resolution | | Descriptor: | DNA (5'(ATCAATATCCACCTGCAGATTCTACCAAAAGTGTATTTGGAAACTGCTCCATCAAAAGGCATGTTCAGCTGAATTCAGCTGAACATGCCTTTTGATGGAGCAGTTTCCAAATACACTTTTGGTAGAATCTGCAGGTGGATATTGAT)3'), MANGANESE (II) ION, histone H2A.1, ... | | Authors: | Davey, C.A, Sargent, D.F, Luger, K, Maeder, A.W, Richmond, T.J. | | Deposit date: | 2002-01-31 | | Release date: | 2002-12-25 | | Last modified: | 2023-08-16 | | Method: | X-RAY DIFFRACTION (2 Å) | | Cite: | Solvent Mediated Interactions in the Structure of the Nucleosome Core Particle at 1.9 A Resolution
J.Mol.Biol., 319, 2002
|
|
1S32
 | | Molecular Recognition of the Nucleosomal 'Supergroove' | | Descriptor: | 2-(2-CARBAMOYLMETHOXY-ETHOXY)-ACETAMIDE, 3-AMINO-(DIMETHYLPROPYLAMINE), 4-AMINO-(1-METHYLIMIDAZOLE)-2-CARBOXYLIC ACID, ... | | Authors: | Edayathumangalam, R.S, Weyermann, P, Gottesfeld, J.M, Dervan, P.B, Luger, K. | | Deposit date: | 2004-01-12 | | Release date: | 2004-05-11 | | Last modified: | 2023-11-15 | | Method: | X-RAY DIFFRACTION (2.05 Å) | | Cite: | Molecular Recognition of the Nucleosomal 'Supergroove'
Proc.Natl.Acad.Sci.USA, 101, 2004
|
|
3UTA
 | | Crystal Structure of Nucleosome Core Particle Assembled with an Alpha-Satellite Sequence Containing Two TTAAA elements (NCP-TA2) | | Descriptor: | 145-mer DNA, CHLORIDE ION, Histone H2A, ... | | Authors: | Chua, E.Y.D, Vasudevan, D, Davey, G.E, Wu, B, Davey, C.A. | | Deposit date: | 2011-11-25 | | Release date: | 2012-04-11 | | Last modified: | 2024-03-20 | | Method: | X-RAY DIFFRACTION (2.07 Å) | | Cite: | The mechanics behind DNA sequence-dependent properties of the nucleosome
Nucleic Acids Res., 40, 2012
|
|
3C1B
 | | The effect of H3 K79 dimethylation and H4 K20 trimethylation on nucleosome and chromatin structure | | Descriptor: | Histone 2, H2bf, Histone H2A type 1, ... | | Authors: | Lu, X, Simon, M, Chodaparambil, J, Hansen, J, Shokat, K, Luger, K. | | Deposit date: | 2008-01-22 | | Release date: | 2008-10-07 | | Last modified: | 2023-11-15 | | Method: | X-RAY DIFFRACTION (2.2 Å) | | Cite: | The effect of H3K79 dimethylation and H4K20 trimethylation on nucleosome and chromatin structure.
Nat.Struct.Mol.Biol., 15, 2008
|
|
3UT9
 | | Crystal Structure of Nucleosome Core Particle Assembled with a Palindromic Widom '601' Derivative (NCP-601L) | | Descriptor: | 145-mer DNA, CHLORIDE ION, Histone H2A, ... | | Authors: | Chua, E.Y.D, Vasudevan, D, Davey, G.E, Wu, B, Davey, C.A. | | Deposit date: | 2011-11-25 | | Release date: | 2012-04-11 | | Last modified: | 2024-03-20 | | Method: | X-RAY DIFFRACTION (2.2 Å) | | Cite: | The mechanics behind DNA sequence-dependent properties of the nucleosome
Nucleic Acids Res., 40, 2012
|
|
3UTB
 | | Crystal Structure of Nucleosome Core Particle Assembled with the 146b Alpha-Satellite Sequence (NCP146b) | | Descriptor: | 146-mer DNA, Histone H2A, Histone H2B 1.1, ... | | Authors: | Chua, E.Y.D, Vasudevan, D, Davey, G.E, Wu, B, Davey, C.A. | | Deposit date: | 2011-11-25 | | Release date: | 2012-04-11 | | Last modified: | 2024-03-20 | | Method: | X-RAY DIFFRACTION (2.2 Å) | | Cite: | The mechanics behind DNA sequence-dependent properties of the nucleosome
Nucleic Acids Res., 40, 2012
|
|
6WZ5
 | |
7TN2
 | | Composite model of a Chd1-nucleosome complex in the nucleotide-free state derived from 2.3A and 2.7A Cryo-EM maps | | Descriptor: | Chromo domain-containing protein 1, DNA Lagging Strand, DNA Tracking Strand, ... | | Authors: | Nodelman, I.M, Bowman, G.D, Armache, J.-P. | | Deposit date: | 2022-01-20 | | Release date: | 2022-03-02 | | Last modified: | 2024-02-21 | | Method: | ELECTRON MICROSCOPY (2.3 Å) | | Cite: | Nucleosome recognition and DNA distortion by the Chd1 remodeler in a nucleotide-free state.
Nat.Struct.Mol.Biol., 29, 2022
|
|
1P3I
 | | Crystallographic Studies of Nucleosome Core Particles containing Histone 'Sin' Mutants | | Descriptor: | Histone H2A, Histone H2B, Histone H3, ... | | Authors: | Muthurajan, U.M, Bao, Y, Forsberg, L.J, Edayathumangalam, R.S, Dyer, P.N, White, C.L, Luger, K. | | Deposit date: | 2003-04-17 | | Release date: | 2004-02-24 | | Last modified: | 2023-08-16 | | Method: | X-RAY DIFFRACTION (2.3 Å) | | Cite: | Crystal structures of histone Sin mutant nucleosomes reveal altered protein-DNA interactions
EMBO J., 23, 2004
|
|
1M19
 | | LIGAND BINDING ALTERS THE STRUCTURE AND DYNAMICS OF NUCLEOSOMAL DNA | | Descriptor: | 3-AMINO-(DIMETHYLPROPYLAMINE), 4-AMINO-(1-METHYLIMIDAZOLE)-2-CARBOXYLIC ACID, 4-AMINO-(1-METHYLPYRROLE)-2-CARBOXYLIC ACID, ... | | Authors: | Suto, R.K, Edayathumangalam, R.S, White, C.L, Melander, C, Gottesfeld, J.M, Dervan, P.B, Luger, K. | | Deposit date: | 2002-06-18 | | Release date: | 2003-02-18 | | Last modified: | 2023-11-15 | | Method: | X-RAY DIFFRACTION (2.3 Å) | | Cite: | Crystal Structures of Nucleosome Core Particles in Complex with Minor Groove DNA-binding Ligands
J.Mol.Biol., 326, 2003
|
|
5OMX
 | |
4J8U
 | |
1P3L
 | | Crystallographic Studies of Nucleosome Core Particles containing Histone 'Sin' Mutants | | Descriptor: | Histone H2A, Histone H2B, Histone H3, ... | | Authors: | Muthurajan, U.M, Bao, Y, Forsberg, L.J, Edayathumangalam, R.S, Dyer, P.N, White, C.L, Luger, K. | | Deposit date: | 2003-04-17 | | Release date: | 2004-02-24 | | Last modified: | 2023-08-16 | | Method: | X-RAY DIFFRACTION (2.4 Å) | | Cite: | Crystal structures of histone Sin mutant nucleosomes reveal altered protein-DNA interactions
EMBO J., 23, 2004
|
|
4XZQ
 | | Nucleosome disassembly by RSC and SWI/SNF is enhanced by H3 acetylation near the nucleosome dyad axis | | Descriptor: | DNA (147-MER), Histone H2A, Histone H2B 1.1, ... | | Authors: | Dechassa, M.L, Luger, K, Chatterjee, N, North, J.A, Manohar, M, Prasad, R, Ottessen, J.J, Poirier, M.G, Bartholomew, B. | | Deposit date: | 2015-02-04 | | Release date: | 2015-10-14 | | Last modified: | 2023-11-15 | | Method: | X-RAY DIFFRACTION (2.4 Å) | | Cite: | Histone Acetylation near the Nucleosome Dyad Axis Enhances Nucleosome Disassembly by RSC and SWI/SNF.
Mol.Cell.Biol., 35, 2015
|
|
4J8W
 | |
4WU8
 | | Structure of trPtNAP-NCP145 | | Descriptor: | DNA (145-MER), Histone H2A type 1, Histone H2B 1.1, ... | | Authors: | Chua, E.Y.D, Davey, C.A. | | Deposit date: | 2014-10-31 | | Release date: | 2015-09-02 | | Last modified: | 2024-03-20 | | Method: | X-RAY DIFFRACTION (2.45 Å) | | Cite: | Stereochemical control of nucleosome targeting by platinum-intercalator antitumor agents.
Nucleic Acids Res., 43, 2015
|
|
1M18
 | | LIGAND BINDING ALTERS THE STRUCTURE AND DYNAMICS OF NUCLEOSOMAL DNA | | Descriptor: | Histone H2A.1, Histone H2B.1, Histone H3.2, ... | | Authors: | Suto, R.K, Edayathumangalam, R.S, White, C.L, Melander, C, Gottesfeld, J.M, Dervan, P.B, Luger, K. | | Deposit date: | 2002-06-18 | | Release date: | 2003-02-18 | | Last modified: | 2024-02-14 | | Method: | X-RAY DIFFRACTION (2.45 Å) | | Cite: | Crystal Structures of Nucleosome Core Particles in Complex with Minor Groove DNA-binding Ligands
J.Mol.Biol., 326, 2003
|
|
3REH
 | |
3MNN
 | | A Ruthenium Antitumour Agent Forms Specific Histone Protein Adducts in the Nucleosome Core | | Descriptor: | 1,3,5-triaza-7-phosphatricyclo[3.3.1.1~3,7~]decane, 1-methyl-4-(1-methylethyl)benzene, DNA (145-MER), ... | | Authors: | Ong, M.S, Davey, C.A. | | Deposit date: | 2010-04-22 | | Release date: | 2011-04-06 | | Last modified: | 2023-11-01 | | Method: | X-RAY DIFFRACTION (2.5 Å) | | Cite: | A ruthenium antimetastasis agent forms specific histone protein adducts in the nucleosome core
Chemistry, 17, 2011
|
|
6ZHX
 | | Cryo-EM structure of the regulatory linker of ALC1 bound to the nucleosome's acidic patch: nucleosome class. | | Descriptor: | Chromodomain-helicase-DNA-binding protein 1-like, DNA (145-MER) Widom 601 sequence, Histone H2A type 1, ... | | Authors: | Bacic, L, Gaullier, G, Croll, T.I, Deindl, S. | | Deposit date: | 2020-06-24 | | Release date: | 2020-12-23 | | Last modified: | 2021-07-14 | | Method: | ELECTRON MICROSCOPY (2.5 Å) | | Cite: | Mechanistic Insights into Regulation of the ALC1 Remodeler by the Nucleosome Acidic Patch.
Cell Rep, 33, 2020
|
|
4Z66
 | | Nucleosome disassembly by RSC and SWI/SNF is enhanced by H3 acetylation near the nucleosome dyad axis | | Descriptor: | DNA (147-MER), Histone H2A, Histone H2B 1.1, ... | | Authors: | Dechassa, M.L, Luger, K, Chatterjee, N, North, J.A, Manohar, M, Prasad, R, Ottessen, J.J, Poirier, M.G, Bartholomew, B. | | Deposit date: | 2015-04-03 | | Release date: | 2015-10-14 | | Last modified: | 2023-11-15 | | Method: | X-RAY DIFFRACTION (2.5 Å) | | Cite: | Histone Acetylation near the Nucleosome Dyad Axis Enhances Nucleosome Disassembly by RSC and SWI/SNF.
Mol.Cell.Biol., 35, 2015
|
|
7OHC
 | |
3REJ
 | |
