Loading
PDBj
MenuPDBj@FacebookPDBj@X(formerly Twitter)PDBj@BlueSkyPDBj@YouTubewwPDB FoundationwwPDBDonate
RCSB PDBPDBeBMRBAdv. SearchSearch help

1KX5

X-Ray Structure of the Nucleosome Core Particle, NCP147, at 1.9 A Resolution

Summary for 1KX5
Entry DOI10.2210/pdb1kx5/pdb
Related1AOI 1KX3 1KX4
DescriptorDNA (5'(ATCAATATCCACCTGCAGATACTACCAAAAGTGTATTTGGAAACTGCTCCATCAAAAGGCATGTTCAGCTGGAATCCAGCTGAACATGCCTTTTGATGGAGCAGTTTCCAAATACACTTTTGGTAGTATCTGCAGGTGGATATTGAT)3'), DNA (5'(ATCAATATCCACCTGCAGATACTACCAAAAGTGTATTTGGAAACTGCTCCATCAAAAGGCATGTTCAGCTGGATTCCAGCTGAACATGCCTTTTGATGGAGCAGTTTCCAAATACACTTTTGGTAGTATCTGCAGGTGGATATTGAT)3'), histone H3, ... (9 entities in total)
Functional Keywordsnucleosome, chromatin, histone, protein-dna interaction, nucleoprotein, supercoiled dna, nucleosome core, protein-dna complex, dna bending, dna curvature, dna-cation binding, dna-metal binding, dna solvation, structural protein-dna complex, structural protein/dna
Biological sourceHomo sapiens (human)
More
Cellular locationNucleus: P16105 P06897 P02281
Total number of polymer chains10
Total formula weight200282.87
Authors
Davey, C.A.,Sargent, D.F.,Luger, K.,Maeder, A.W.,Richmond, T.J. (deposition date: 2002-01-31, release date: 2002-12-25, Last modification date: 2023-08-16)
Primary citationDavey, C.A.,Sargent, D.F.,Luger, K.,Maeder, A.W.,Richmond, T.J.
Solvent Mediated Interactions in the Structure of the Nucleosome Core Particle at 1.9 A Resolution
J.Mol.Biol., 319:1097-1113, 2002
Cited by
PubMed Abstract: Solvent binding in the nucleosome core particle containing a 147 base pair, defined-sequence DNA is characterized from the X-ray crystal structure at 1.9 A resolution. A single-base-pair increase in DNA length over that used previously results in substantially improved clarity of the electron density and accuracy for the histone protein and DNA atomic coordinates. The reduced disorder has allowed for the first time extensive modeling of water molecules and ions. Over 3000 water molecules and 18 ions have been identified. Water molecules acting as hydrogen-bond bridges between protein and DNA are approximately equal in number to the direct hydrogen bonds between these components. Bridging water molecules have a dual role in promoting histone-DNA association not only by providing further stability to direct protein-DNA interactions, but also by enabling formation of many additional interactions between more distantly related elements. Water molecules residing in the minor groove play an important role in facilitating insertion of arginine side-chains. Water structure at the interface of the histones and DNA provides a means of accommodating intrinsic DNA conformational variation, thus limiting the sequence dependency of nucleosome positioning while enhancing mobility. Monovalent anions are bound near the N termini of histone alpha-helices that are not occluded by DNA phosphate groups. Their location in proximity to the DNA phosphodiester backbone suggests that they damp the electrostatic interaction between the histone proteins and the DNA. Divalent cations are bound at specific sites in the nucleosome core particle and contribute to histone-histone and histone-DNA interparticle interactions. These interactions may be relevant to nucleosome association in arrays.
PubMed: 12079350
DOI: 10.1016/S0022-2836(02)00386-8
PDB entries with the same primary citation
Experimental method
X-RAY DIFFRACTION (1.94 Å)
Structure validation

251174

PDB entries from 2026-03-25

PDB statisticsPDBj update infoContact PDBjnumon