1KX5

X-Ray Structure of the Nucleosome Core Particle, NCP147, at 1.9 A Resolution

Summary for 1KX5

Related1AOI 1KX3 1KX4
DescriptorDNA (5'(ATCAATATCCACCTGCAGATACTACCAAAAGTGTATTTGGAAACTGCTCCATCAAAAGGCATGTTCAGCTGGAATCCAGCTGAACATGCCTTTTGATGGAGCAGTTTCCAAATACACTTTTGGTAGTATCTGCAGGTGGATATTGAT)3'), DNA (5'(ATCAATATCCACCTGCAGATACTACCAAAAGTGTATTTGGAAACTGCTCCATCAAAAGGCATGTTCAGCTGGATTCCAGCTGAACATGCCTTTTGATGGAGCAGTTTCCAAATACACTTTTGGTAGTATCTGCAGGTGGATATTGAT)3'), histone H3, ... (9 entities in total)
Functional Keywordsnucleosome, chromatin, histone, protein-dna interaction, nucleoprotein, supercoiled dna, nucleosome core, protein-dna complex, dna bending, dna curvature, dna-cation binding, dna-metal binding, dna solvation, structural protein-dna complex, structural protein/dna
Biological sourceHomo sapiens (human)
More
Cellular locationNucleus P16105 P06897 P02281
Total number of polymer chains10
Total molecular weight200282.87
Authors
Davey, C.A.,Sargent, D.F.,Luger, K.,Maeder, A.W.,Richmond, T.J. (deposition date: 2002-01-31, release date: 2002-12-25, Last modification date: 2011-07-13)
Primary citation
Davey, C.A.,Sargent, D.F.,Luger, K.,Maeder, A.W.,Richmond, T.J.
Solvent Mediated Interactions in the Structure of the Nucleosome Core Particle at 1.9 A Resolution
J.Mol.Biol., 319:1097-1113, 2002
PubMed: 12079350 (PDB entries with the same primary citation)
DOI: 10.1016/S0022-2836(02)00386-8
MImport into Mendeley
Experimental method
X-RAY DIFFRACTION (1.94 Å)
NMR Information
?

Structure validation

ClashscoreRamachandran outliersSidechain outliers187.6%3.7%MetricValuePercentile RanksWorseBetterPercentile relative to all X-ray structuresPercentile relative to X-ray structures of similar resolution
Download full validation report