PDB: 72308 resultsInfo pagesStatus searchChemie searchBIRD

---

5DZR	Structure of RNA Helicase FRH a Critical Component of the Neurospora Crassa Circadian Clock Descriptor: FRQ-interacting RNA helicase Authors: Conrad, K.S, Crane, B.C. Deposit date: 2015-09-26 Release date: 2016-07-06 Last modified: 2023-09-27 Method: X-RAY DIFFRACTION (3.161 Å) Cite: Structure of the frequency-interacting RNA helicase: a protein interaction hub for the circadian clock. Embo J., 35, 2016
2FOW	THE RNA BINDING DOMAIN OF RIBOSOMAL PROTEIN L11: THREE-DIMENSIONAL STRUCTURE OF THE RNA-BOUND FORM OF THE PROTEIN, NMR, 26 STRUCTURES Descriptor: RIBOSOMAL PROTEIN L11 Authors: Hinck, A.P, Markus, M.A, Huang, S, Grzesiek, S, Kustanovich, I, Draper, D.E, Torchia, D.A. Deposit date: 1997-05-26 Release date: 1997-11-26 Last modified: 2024-05-29 Method: SOLUTION NMR Cite: The RNA binding domain of ribosomal protein L11: three-dimensional structure of the RNA-bound form of the protein and its interaction with 23 S rRNA. J.Mol.Biol., 274, 1997
1MUV	Sheared A(anti)-A(anti) Base Pairs in a Destabilizing 2x2 Internal Loop: The NMR Structure of 5'(rGGCAAGCCU)2 Descriptor: 5'-R(*GP*GP*CP*AP*AP*GP*CP*CP*U)-3' Authors: Znosko, B.M, Burkard, M.E, Schroeder, S.J, Krugh, T.R, Turner, D.H. Deposit date: 2002-09-24 Release date: 2002-12-18 Last modified: 2024-05-22 Method: SOLUTION NMR Cite: Sheared Aanti-Aanti Base Pairs in a Destabilizing 2x2 Internal Loop: The NMR Structure of 5'(rGGCAAGCCU)2 Biochemistry, 41, 2002
3N6N	crystal structure of EV71 RdRp in complex with Br-UTP Descriptor: 5-bromouridine 5'-(tetrahydrogen triphosphate), NICKEL (II) ION, RNA-dependent RNA polymerase Authors: Wu, Y, Lou, Z.Y, Miao, Y, Yu, Y, Rao, Z.H. Deposit date: 2010-05-26 Release date: 2011-06-15 Last modified: 2023-11-01 Method: X-RAY DIFFRACTION (2.9 Å) Cite: Structures of EV71 RNA-dependent RNA polymerase in complex with substrate and analogue provide a drug target against the hand-foot-and-mouth disease pandemic in China. Protein Cell, 1, 2010
3BSX	Crystal Structure of Human Pumilio 1 in complex with Puf5 RNA Descriptor: 5'-R(*UP*UP*GP*UP*AP*AP*UP*AP*UP*UP*A)-3', Pumilio homolog 1 Authors: Gupta, Y.K, Nair, D.T, Wharton, R.P, Aggarwal, A.K. Deposit date: 2007-12-26 Release date: 2008-04-08 Last modified: 2023-11-01 Method: X-RAY DIFFRACTION (2.32 Å) Cite: Structures of human Pumilio with noncognate RNAs reveal molecular mechanisms for binding promiscuity. Structure, 16, 2008
2D1P	crystal structure of heterohexameric TusBCD proteins, which are crucial for the tRNA modification Descriptor: Hypothetical UPF0116 protein yheM, Hypothetical UPF0163 protein yheN, Hypothetical protein yheL, ... Authors: Numata, T, Fukai, S, Ikeuchi, Y, Suzuki, T, Nureki, O. Deposit date: 2005-08-30 Release date: 2006-02-28 Last modified: 2024-03-13 Method: X-RAY DIFFRACTION (2.15 Å) Cite: Structural Basis for Sulfur Relay to RNA Mediated by Heterohexameric TusBCD Complex Structure, 14, 2006
6QI4	NCS-1 bound to a ligand Descriptor: 2-(1~{H}-indol-3-yl)-~{N}-[(~{E})-(4-nitro-3-oxidanyl-phenyl)methylideneamino]ethanamide, ACETATE ION, CALCIUM ION, ... Authors: Sanchez-Barrena, M.J, Blanco-Gabella, P. Deposit date: 2019-01-17 Release date: 2019-07-17 Last modified: 2024-01-24 Method: X-RAY DIFFRACTION (1.78 Å) Cite: Insights into real-time chemical processes in a calcium sensor protein-directed dynamic library. Nat Commun, 10, 2019
7MLX	SARS-CoV-2 programmed -1 frameshifting element three stem H-type pseudoknot Descriptor: BL3-6 Fab Heavy Chain, BL3-6 Fab Light Chain, RNA (65-MER) Authors: Roman, C, Lewicka, A. Deposit date: 2021-04-29 Release date: 2021-08-11 Last modified: 2024-04-03 Method: X-RAY DIFFRACTION (2.09 Å) Cite: The SARS-CoV-2 Programmed -1 Ribosomal Frameshifting Element Crystal Structure Solved to 2.09 angstrom Using Chaperone-Assisted RNA Crystallography. Acs Chem.Biol., 16, 2021
3Q0A	X-ray crystal structure of the transcription initiation complex of the N4 mini-vRNAP with P2 promoter: Mismatch complex Descriptor: DNA (5'-D(*TP*GP*CP*CP*TP*CP*CP*CP*AP*GP*GP*CP*A*GP*TP*CP*AP*AP*AP*AP*GP*AP*AP*GP*CP*GP*GP*AP*GP*CP*TP*TP*CP*TP*TP*C)-3'), GUANOSINE-5'-TRIPHOSPHATE, PHOSPHATE ION, ... Authors: Murakami, K.S. Deposit date: 2010-12-15 Release date: 2011-02-23 Last modified: 2024-02-21 Method: X-RAY DIFFRACTION (2.69 Å) Cite: X-ray crystal structures elucidate the nucleotidyl transfer reaction of transcript initiation using two nucleotides. Proc.Natl.Acad.Sci.USA, 108, 2011
2JLU	Dengue virus 4 NS3 helicase in complex with ssRNA Descriptor: 5'-R(*AP*GP*AP*CP*UP*AP*AP*CP*AP*AP*CP*U)-3', GLYCEROL, SERINE PROTEASE SUBUNIT NS3 Authors: Luo, D.H, Xu, T, Watson, R.P, Becker, D.S, Sampath, A, Jahnke, W, Yeong, S.S, Wang, C.H, Lim, S.P, Vasudevan, S.G, Lescar, J. Deposit date: 2008-09-15 Release date: 2008-11-25 Last modified: 2023-12-13 Method: X-RAY DIFFRACTION (2.04 Å) Cite: Insights Into RNA Unwinding and ATP Hydrolysis by the Flavivirus Ns3 Protein. Embo J., 27, 2008
4QU7	Crystal structure of a G-rich RNA sequence binding factor 1 (GRSF1) from Homo sapiens at 2.50 A resolution Descriptor: G-rich sequence factor 1, RNA 5'-(*AP*GP*GP*GP*AP*UP)-3' Authors: Joint Center for Structural Genomics (JCSG), Partnership for T-Cell Biology (TCELL) Deposit date: 2014-07-10 Release date: 2014-08-13 Last modified: 2023-09-20 Method: X-RAY DIFFRACTION (2.5 Å) Cite: Crystal structure of a G-rich RNA sequence binding factor 1 (GRSF1) from Homo sapiens at 2.50 A resolution To be published
2JLX	Dengue virus 4 NS3 helicase in complex with ssRNA and ADP-Vanadate Descriptor: 5'-R(*AP*GP*AP*CP*UP*AP*AP*CP*AP*AP*CP*U)-3', ADENOSINE-5'-DIPHOSPHATE, CHLORIDE ION, ... Authors: Luo, D.H, Xu, T, Watson, R.P, Becker, D.S, Sampath, A, Jahnke, W, Yeong, S.S, Wang, C.H, Lim, S.P, Vasudevan, S.G, Lescar, J. Deposit date: 2008-09-15 Release date: 2008-11-25 Last modified: 2023-12-13 Method: X-RAY DIFFRACTION (2.2 Å) Cite: Insights Into RNA Unwinding and ATP Hydrolysis by the Flavivirus Ns3 Protein. Embo J., 27, 2008
2JLW	Dengue virus 4 NS3 helicase in complex with ssRNA2 Descriptor: 5'-R(*UP*AP*GP*AP*CP*UP*AP*AP*CP*AP*AP*CP*U)-3', GLYCEROL, PHOSPHATE ION, ... Authors: Luo, D.H, Xu, T, Watson, R.P, Becker, D.S, Sampath, A, Jahnke, W, Yeong, S.S, Wang, C.H, Lim, S.P, Vasudevan, S.G, Lescar, J. Deposit date: 2008-09-15 Release date: 2008-11-25 Last modified: 2023-12-13 Method: X-RAY DIFFRACTION (2.6 Å) Cite: Insights Into RNA Unwinding and ATP Hydrolysis by the Flavivirus Ns3 Protein Embo J., 27, 2008
2JLY	Dengue virus 4 NS3 helicase in complex with ssRNA and ADP-Phosphate Descriptor: 5'-R(*AP*GP*AP*CP*UP*AP*AP*CP*AP*AP*CP*U)-3', ADENOSINE-5'-DIPHOSPHATE, GLYCEROL, ... Authors: Luo, D.H, Xu, T, Watson, R.P, Becker, D.S, Sampath, A, Jahnke, W, Yeong, S.S, Wang, C.H, Lim, S.P, Vasudevan, S.G, Lescar, J. Deposit date: 2008-09-15 Release date: 2008-11-25 Last modified: 2023-12-13 Method: X-RAY DIFFRACTION (2.4 Å) Cite: Insights Into RNA Unwinding and ATP Hydrolysis by the Flavivirus Ns3 Protein. Embo J., 27, 2008
3O7X	Crystal structure of human Hili PAZ domain Descriptor: Piwi-like protein 2 Authors: Tian, Y, Simanshu, D.K, Ma, J.-B, Patel, D.J. Deposit date: 2010-08-01 Release date: 2011-01-12 Last modified: 2024-02-21 Method: X-RAY DIFFRACTION (2.9248 Å) Cite: Inaugural Article: Structural basis for piRNA 2'-O-methylated 3'-end recognition by Piwi PAZ (Piwi/Argonaute/Zwille) domains. Proc.Natl.Acad.Sci.USA, 108, 2011
2JLV	Dengue virus 4 NS3 helicase in complex with ssRNA and AMPPNP Descriptor: 5'-R(*AP*GP*AP*CP*UP*AP*AP*CP*AP*AP*CP*U)-3', CHLORIDE ION, GLYCEROL, ... Authors: Luo, D.H, Xu, T, Watson, R.P, Becker, D.S, Sampath, A, Jahnke, W, Yeong, S.S, Wang, C.H, Lim, S.P, Vasudevan, S.G, Lescar, J. Deposit date: 2008-09-15 Release date: 2008-11-25 Last modified: 2023-12-13 Method: X-RAY DIFFRACTION (1.9 Å) Cite: Insights Into RNA Unwinding and ATP Hydrolysis by the Flavivirus Ns3 Protein Embo J., 27, 2008
2JLZ	Dengue virus 4 NS3 helicase in complex with ssRNA and ADP Descriptor: 5'-R(*AP*GP*AP*CP*UP*AP*AP*CP*AP*AP*CP*U)-3', ADENOSINE-5'-DIPHOSPHATE, CHLORIDE ION, ... Authors: Luo, D.H, Xu, T, Watson, R.P, Becker, D.S, Sampath, A, Jahnke, W, Yeong, S.S, Wang, C.H, Lim, S.P, Vasudevan, S.G, Lescar, J. Deposit date: 2008-09-15 Release date: 2008-11-25 Last modified: 2023-12-13 Method: X-RAY DIFFRACTION (2.2 Å) Cite: Insights Into RNA Unwinding and ATP Hydrolysis by the Flavivirus Ns3 Protein. Embo J., 27, 2008
1NLC	HIV-1 DIS(Mal) duplex Zn-soaked Descriptor: HIV-1 DIS(MAL) genomic RNA, ZINC ION Authors: Ennifar, E, Walter, P, Dumas, P. Deposit date: 2003-01-07 Release date: 2003-05-13 Last modified: 2024-02-14 Method: X-RAY DIFFRACTION (1.85 Å) Cite: A crystallographic study of the binding of 13 metal ions to two related RNA duplexes. Nucleic Acids Res., 31, 2003
1FG0	LARGE RIBOSOMAL SUBUNIT COMPLEXED WITH A 13 BP MINIHELIX-PUROMYCIN COMPOUND Descriptor: 23S RIBOSOMAL RNA, 5'-R(CCGGCGGGCUGGUUCAAACCGGCCCGCCGGACC)-3'-5'-R(P-PUROMYCIN)-3' Authors: Nissen, P, Hansen, J, Ban, N, Moore, P.B, Steitz, T.A. Deposit date: 2000-07-26 Release date: 2000-08-28 Last modified: 2024-02-07 Method: X-RAY DIFFRACTION (3 Å) Cite: The structural basis of ribosome activity in peptide bond synthesis. Science, 289, 2000
2AUK	Structure of E. coli RNA polymerase beta' G/G' insert Descriptor: DNA-directed RNA polymerase beta' chain Authors: Chlenov, M, Masuda, S, Murakami, K.S, Nikiforov, V, Darst, S.A, Mustaev, A. Deposit date: 2005-08-28 Release date: 2005-10-04 Last modified: 2024-02-14 Method: X-RAY DIFFRACTION (2.3 Å) Cite: Structure and Function of Lineage-specific Sequence Insertions in the Bacterial RNA Polymerase beta' Subunit J.Mol.Biol., 353, 2005
4KN4	X-ray crystal structure of the Escherichia coli RNA polymerase in complex with Benzoxazinorifamycin-2b Descriptor: Benzoxazinorifamycin-2b, DNA-directed RNA polymerase subunit alpha, DNA-directed RNA polymerase subunit beta, ... Authors: Murakami, K.S. Deposit date: 2013-05-08 Release date: 2013-05-22 Last modified: 2023-09-20 Method: X-RAY DIFFRACTION (3.965 Å) Cite: X-ray Crystal Structures of the Escherichia coli RNA Polymerase in Complex with Benzoxazinorifamycins. J.Med.Chem., 56, 2013
4KN7	X-ray crystal structure of the Escherichia coli RNA polymerase in complex with Benzoxazinorifamycin-2c Descriptor: Benzoxazinorifamycin-2c, DNA-directed RNA polymerase subunit alpha, DNA-directed RNA polymerase subunit beta, ... Authors: Murakami, K.S. Deposit date: 2013-05-08 Release date: 2013-05-22 Last modified: 2023-09-20 Method: X-RAY DIFFRACTION (3.686 Å) Cite: X-ray Crystal Structures of the Escherichia coli RNA Polymerase in Complex with Benzoxazinorifamycins. J.Med.Chem., 56, 2013
2AUJ	Structure of Thermus aquaticus RNA polymerase beta'-subunit insert Descriptor: DNA-directed RNA polymerase beta' chain Authors: Chlenov, M, Masuda, S, Murakami, K.S, Nikiforov, V, Darst, S.A, Mustaev, A. Deposit date: 2005-08-27 Release date: 2005-10-04 Last modified: 2024-02-14 Method: X-RAY DIFFRACTION (2.7 Å) Cite: Structure and Function of Lineage-specific Sequence Insertions in the Bacterial RNA Polymerase beta' Subunit J.Mol.Biol., 353, 2005
4KMU	X-ray crystal structure of the Escherichia coli RNA polymerase in complex with Rifampin Descriptor: DNA-directed RNA polymerase subunit alpha, DNA-directed RNA polymerase subunit beta, DNA-directed RNA polymerase subunit beta', ... Authors: Murakami, K.S. Deposit date: 2013-05-08 Release date: 2013-05-22 Last modified: 2023-09-20 Method: X-RAY DIFFRACTION (3.85 Å) Cite: X-ray Crystal Structures of the Escherichia coli RNA Polymerase in Complex with Benzoxazinorifamycins. J.Med.Chem., 56, 2013
4JGZ	Crystal structure of human coxsackievirus A16 uncoating intermediate (space group I222) Descriptor: Polyprotein, capsid protein VP1, capsid protein VP2, ... Authors: Ren, J, Wang, X, Hu, Z, Gao, Q, Sun, Y, Li, X, Porta, C, Walter, T.S, Gilbert, R.J, Zhao, Y, Axford, D, Williams, M, McAuley, K, Rowlands, D.J, Yin, W, Wang, J, Stuart, D.I, Rao, Z, Fry, E.E. Deposit date: 2013-03-04 Release date: 2013-06-05 Last modified: 2023-09-20 Method: X-RAY DIFFRACTION (3 Å) Cite: Picornavirus uncoating intermediate captured in atomic detail. Nat Commun, 4, 2013

<301302303304305306307308309310311312313314315316>