2X4W
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 2x4w by Molmil](/molmil-images/mine/2x4w) | Molecular basis of Histone H3K36me3 recognition by the PWWP domain of BRPF1. | Descriptor: | FORMIC ACID, HISTONE H3.2, PEREGRIN | Authors: | Vezzoli, A, Bonadies, N, Allen, M.D, Freund, S.M.V, Santiveri, C.M, Kvinlaug, B, Huntly, B.J.P, Gottgens, B, Bycroft, M. | Deposit date: | 2010-02-02 | Release date: | 2010-04-21 | Last modified: | 2018-01-24 | Method: | X-RAY DIFFRACTION (1.5 Å) | Cite: | Molecular Basis of Histone H3K36Me3 Recognition by the Pwwp Domain of Brpf1. Nat.Struct.Mol.Biol., 17, 2010
|
|
3MO8
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 3mo8 by Molmil](/molmil-images/mine/3mo8) | PWWP Domain of Human Bromodomain and PHD finger-containing protein 1 In Complex with Trimethylated H3K36 Peptide | Descriptor: | Histone H3.2 TRIMETHYLATED H3K36 PEPTIDE, Peregrin | Authors: | Lam, R, Zeng, H, Ni, S, Bountra, C, Weigelt, J, Arrowsmith, C.H, Edwards, A.M, Bochkarev, A, Min, J, Wu, H, Structural Genomics Consortium (SGC) | Deposit date: | 2010-04-22 | Release date: | 2010-06-02 | Last modified: | 2023-09-06 | Method: | X-RAY DIFFRACTION (1.69 Å) | Cite: | Structural and Histone Binding Ability Characterizations of Human PWWP Domains. Plos One, 6, 2011
|
|
4MZG
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 4mzg by Molmil](/molmil-images/mine/4mzg) | Crystal structure of human Spindlin1 bound to histone H3K4me3 peptide | Descriptor: | (4R)-2-METHYLPENTANE-2,4-DIOL, (4S)-2-METHYL-2,4-PENTANEDIOL, CHLORIDE ION, ... | Authors: | Su, X, Ding, X, Li, H. | Deposit date: | 2013-09-30 | Release date: | 2014-03-26 | Method: | X-RAY DIFFRACTION (1.698 Å) | Cite: | Molecular basis underlying histone H3 lysine-arginine methylation pattern readout by Spin/Ssty repeats of Spindlin1 Genes Dev., 28, 2014
|
|
2X4Y
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 2x4y by Molmil](/molmil-images/mine/2x4y) | Molecular basis of Histone H3K36me3 recognition by the PWWP domain of BRPF1. | Descriptor: | HISTONE H3.2, PEREGRIN, SULFATE ION | Authors: | Vezzoli, A, Bonadies, N, Allen, M.D, Freund, S.M.V, Santiveri, C.M, Kvinlaug, B, Huntly, B.J.P, Gottgens, B, Bycroft, M. | Deposit date: | 2010-02-02 | Release date: | 2010-04-21 | Last modified: | 2018-01-24 | Method: | X-RAY DIFFRACTION (1.7 Å) | Cite: | Molecular Basis of Histone H3K36Me3 Recognition by the Pwwp Domain of Brpf1. Nat.Struct.Mol.Biol., 17, 2010
|
|
2HUE
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 2hue by Molmil](/molmil-images/mine/2hue) | Structure of the H3-H4 chaperone Asf1 bound to histones H3 and H4 | Descriptor: | Anti-silencing protein 1, GLYCEROL, Histone H3, ... | Authors: | English, C.M, Churchill, M.E.A, Tyler, J.K. | Deposit date: | 2006-07-26 | Release date: | 2006-11-21 | Last modified: | 2024-02-14 | Method: | X-RAY DIFFRACTION (1.7 Å) | Cite: | Structural basis for the histone chaperone activity of asf1. Cell(Cambridge,Mass.), 127, 2006
|
|
3GV6
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 3gv6 by Molmil](/molmil-images/mine/3gv6) | Crystal Structure of human chromobox homolog 6 (CBX6) with H3K9 peptide | Descriptor: | Chromobox protein homolog 6, Histone H3K9me3 peptide | Authors: | Dong, A, Amaya, M.F, Li, Z, Loppnau, P, Kozieradzki, I, Edwards, A.M, Arrowsmith, C.H, Weigelt, J, Bountra, C, Bochkarev, A, Min, J, Ouyang, H, Structural Genomics Consortium (SGC) | Deposit date: | 2009-03-30 | Release date: | 2009-04-21 | Last modified: | 2023-09-06 | Method: | X-RAY DIFFRACTION (1.76 Å) | Cite: | Recognition and specificity determinants of the human cbx chromodomains. J.Biol.Chem., 286, 2011
|
|
2X4X
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 2x4x by Molmil](/molmil-images/mine/2x4x) | Molecular basis of Histone H3K36me3 recognition by the PWWP domain of BRPF1. | Descriptor: | HISTONE H3.2, PEREGRIN, SULFATE ION | Authors: | Vezzoli, A, Bonadies, N, Allen, M.D, Freund, S.M.V, Santiveri, C.M, Kvinlaug, B, Huntly, B.J.P, Gottgens, B, Bycroft, M. | Deposit date: | 2010-02-02 | Release date: | 2010-04-21 | Last modified: | 2018-01-24 | Method: | X-RAY DIFFRACTION (1.85 Å) | Cite: | Molecular Basis of Histone H3K36Me3 Recognition by the Pwwp Domain of Brpf1. Nat.Struct.Mol.Biol., 17, 2010
|
|
4OUC
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 4ouc by Molmil](/molmil-images/mine/4ouc) | Structure of human haspin in complex with histone H3 substrate | Descriptor: | (2R,3R,4S,5R)-2-(4-AMINO-5-IODO-7H-PYRROLO[2,3-D]PYRIMIDIN-7-YL)-5-(HYDROXYMETHYL)TETRAHYDROFURAN-3,4-DIOL, 1,2-ETHANEDIOL, Histone H3.2, ... | Authors: | Chaikuad, A, von Delft, F, Arrowsmith, C.H, Edwards, A.M, Bountra, C, Knapp, S, Structural Genomics Consortium (SGC) | Deposit date: | 2014-02-15 | Release date: | 2014-04-16 | Last modified: | 2023-09-20 | Method: | X-RAY DIFFRACTION (1.9 Å) | Cite: | Modulation of the chromatin phosphoproteome by the haspin protein kinase. Mol Cell Proteomics, 13, 2014
|
|
1KX5
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 1kx5 by Molmil](/molmil-images/mine/1kx5) | X-Ray Structure of the Nucleosome Core Particle, NCP147, at 1.9 A Resolution | Descriptor: | CHLORIDE ION, DNA (5'(ATCAATATCCACCTGCAGATACTACCAAAAGTGTATTTGGAAACTGCTCCATCAAAAGGCATGTTCAGCTGGAATCCAGCTGAACATGCCTTTTGATGGAGCAGTTTCCAAATACACTTTTGGTAGTATCTGCAGGTGGATATTGAT)3'), DNA (5'(ATCAATATCCACCTGCAGATACTACCAAAAGTGTATTTGGAAACTGCTCCATCAAAAGGCATGTTCAGCTGGATTCCAGCTGAACATGCCTTTTGATGGAGCAGTTTCCAAATACACTTTTGGTAGTATCTGCAGGTGGATATTGAT)3'), ... | Authors: | Davey, C.A, Sargent, D.F, Luger, K, Maeder, A.W, Richmond, T.J. | Deposit date: | 2002-01-31 | Release date: | 2002-12-25 | Last modified: | 2023-08-16 | Method: | X-RAY DIFFRACTION (1.94 Å) | Cite: | Solvent Mediated Interactions in the Structure of the Nucleosome Core Particle at 1.9 A Resolution J.Mol.Biol., 319, 2002
|
|
5VAC
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 5vac by Molmil](/molmil-images/mine/5vac) | Crystal Structure of ATXR5 SET domain in complex with K36me3 histone H3 peptide | Descriptor: | DIMETHYL SULFOXIDE, Histone H3.2, Probable Histone-lysine N-methyltransferase ATXR5, ... | Authors: | Bergamin, E, Sarvan, S, Malette, J, Eram, M, Yeung, S, Mongeon, V, Joshi, M, Brunzelle, J.S, Michaels, S.D, Blais, A, Vedadi, M, Couture, J.F. | Deposit date: | 2017-03-24 | Release date: | 2017-04-19 | Last modified: | 2023-10-04 | Method: | X-RAY DIFFRACTION (1.949 Å) | Cite: | Molecular basis for the methylation specificity of ATXR5 for histone H3. Nucleic Acids Res., 45, 2017
|
|
7UVA
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 7uva by Molmil](/molmil-images/mine/7uva) | Crystal structure of KDM2A histone demethylase catalytic domain in complex with an H3C36 peptide modified by UNC8015 | Descriptor: | FE (III) ION, Histone H3.2, Lysine-specific demethylase 2A, ... | Authors: | Budziszewski, G.R, Azzam, D.N, Spangler, C.J, Skrajna, A, Foley, C.A, James, L.I, Frye, S.V, McGinty, R.K. | Deposit date: | 2022-04-29 | Release date: | 2023-02-22 | Last modified: | 2023-10-25 | Method: | X-RAY DIFFRACTION (1.98 Å) | Cite: | Structural basis of paralog-specific KDM2A/B nucleosome recognition. Nat.Chem.Biol., 19, 2023
|
|
6ACE
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 6ace by Molmil](/molmil-images/mine/6ace) | |
5B0Z
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 5b0z by Molmil](/molmil-images/mine/5b0z) | The crystal structure of the nucleosome containing H3.2, at 1.98 A resolution | Descriptor: | CHLORIDE ION, DNA (146-MER), Histone H2A type 1-B/E, ... | Authors: | Suzuki, Y, Horikoshi, N, Kato, D, Kurumizaka, H. | Deposit date: | 2015-11-14 | Release date: | 2016-01-27 | Last modified: | 2023-11-08 | Method: | X-RAY DIFFRACTION (1.987 Å) | Cite: | Crystal structure of the nucleosome containing histone H3 with crotonylated lysine 122 Biochem.Biophys.Res.Commun., 469, 2016
|
|
1KX3
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 1kx3 by Molmil](/molmil-images/mine/1kx3) | X-Ray Structure of the Nucleosome Core Particle, NCP146, at 2.0 A Resolution | Descriptor: | DNA (5'(ATCAATATCCACCTGCAGATTCTACCAAAAGTGTATTTGGAAACTGCTCCATCAAAAGGCATGTTCAGCTGAATTCAGCTGAACATGCCTTTTGATGGAGCAGTTTCCAAATACACTTTTGGTAGAATCTGCAGGTGGATATTGAT)3'), MANGANESE (II) ION, histone H2A.1, ... | Authors: | Davey, C.A, Sargent, D.F, Luger, K, Maeder, A.W, Richmond, T.J. | Deposit date: | 2002-01-31 | Release date: | 2002-12-25 | Last modified: | 2023-08-16 | Method: | X-RAY DIFFRACTION (2 Å) | Cite: | Solvent Mediated Interactions in the Structure of the Nucleosome Core Particle at 1.9 A Resolution J.Mol.Biol., 319, 2002
|
|
4QEO
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 4qeo by Molmil](/molmil-images/mine/4qeo) | crystal structure of KRYPTONITE in complex with mCHH DNA, H3(1-15) peptide and SAH | Descriptor: | DNA 5'-ACTGATGAGTACCAT-3', DNA 5'-GGTACT(5CM)ATCAGTAT-3', Histone H3, ... | Authors: | Du, J, Li, S, Patel, D.J. | Deposit date: | 2014-05-17 | Release date: | 2014-07-30 | Last modified: | 2024-03-13 | Method: | X-RAY DIFFRACTION (2 Å) | Cite: | Mechanism of DNA Methylation-Directed Histone Methylation by KRYPTONITE. Mol.Cell, 55, 2014
|
|
1S32
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 1s32 by Molmil](/molmil-images/mine/1s32) | Molecular Recognition of the Nucleosomal 'Supergroove' | Descriptor: | 2-(2-CARBAMOYLMETHOXY-ETHOXY)-ACETAMIDE, 3-AMINO-(DIMETHYLPROPYLAMINE), 4-AMINO-(1-METHYLIMIDAZOLE)-2-CARBOXYLIC ACID, ... | Authors: | Edayathumangalam, R.S, Weyermann, P, Gottesfeld, J.M, Dervan, P.B, Luger, K. | Deposit date: | 2004-01-12 | Release date: | 2004-05-11 | Last modified: | 2023-11-15 | Method: | X-RAY DIFFRACTION (2.05 Å) | Cite: | Molecular Recognition of the Nucleosomal 'Supergroove' Proc.Natl.Acad.Sci.USA, 101, 2004
|
|
3R93
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 3r93 by Molmil](/molmil-images/mine/3r93) | Crystal structure of the chromo domain of M-phase phosphoprotein 8 bound to H3K9Me3 peptide | Descriptor: | H3K9Me3 peptide, M-phase phosphoprotein 8, UNKNOWN ATOM OR ION | Authors: | Li, J, Li, Z, Ruan, J, Xu, C, Tong, Y, Pan, P.W, Tempel, W, Crombet, L, Min, J, Zang, J, Structural Genomics Consortium (SGC) | Deposit date: | 2011-03-24 | Release date: | 2011-04-06 | Last modified: | 2023-09-13 | Method: | X-RAY DIFFRACTION (2.057 Å) | Cite: | Structural basis for specific binding of human MPP8 chromodomain to histone H3 methylated at lysine 9. Plos One, 6, 2011
|
|
3UTA
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 3uta by Molmil](/molmil-images/mine/3uta) | Crystal Structure of Nucleosome Core Particle Assembled with an Alpha-Satellite Sequence Containing Two TTAAA elements (NCP-TA2) | Descriptor: | 145-mer DNA, CHLORIDE ION, Histone H2A, ... | Authors: | Chua, E.Y.D, Vasudevan, D, Davey, G.E, Wu, B, Davey, C.A. | Deposit date: | 2011-11-25 | Release date: | 2012-04-11 | Last modified: | 2024-03-20 | Method: | X-RAY DIFFRACTION (2.07 Å) | Cite: | The mechanics behind DNA sequence-dependent properties of the nucleosome Nucleic Acids Res., 40, 2012
|
|
4MZF
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 4mzf by Molmil](/molmil-images/mine/4mzf) | Crystal structure of human Spindlin1 bound to histone H3(K4me3-R8me2a) peptide | Descriptor: | CHLORIDE ION, MAGNESIUM ION, Peptide from Histone H3.2, ... | Authors: | Su, X, Ding, X, Li, H. | Deposit date: | 2013-09-30 | Release date: | 2014-03-26 | Method: | X-RAY DIFFRACTION (2.098 Å) | Cite: | Molecular basis underlying histone H3 lysine-arginine methylation pattern readout by Spin/Ssty repeats of Spindlin1 Genes Dev., 28, 2014
|
|
6WZ5
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 6wz5 by Molmil](/molmil-images/mine/6wz5) | |
3UTB
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 3utb by Molmil](/molmil-images/mine/3utb) | Crystal Structure of Nucleosome Core Particle Assembled with the 146b Alpha-Satellite Sequence (NCP146b) | Descriptor: | 146-mer DNA, Histone H2A, Histone H2B 1.1, ... | Authors: | Chua, E.Y.D, Vasudevan, D, Davey, G.E, Wu, B, Davey, C.A. | Deposit date: | 2011-11-25 | Release date: | 2012-04-11 | Last modified: | 2024-03-20 | Method: | X-RAY DIFFRACTION (2.2 Å) | Cite: | The mechanics behind DNA sequence-dependent properties of the nucleosome Nucleic Acids Res., 40, 2012
|
|
3UT9
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 3ut9 by Molmil](/molmil-images/mine/3ut9) | Crystal Structure of Nucleosome Core Particle Assembled with a Palindromic Widom '601' Derivative (NCP-601L) | Descriptor: | 145-mer DNA, CHLORIDE ION, Histone H2A, ... | Authors: | Chua, E.Y.D, Vasudevan, D, Davey, G.E, Wu, B, Davey, C.A. | Deposit date: | 2011-11-25 | Release date: | 2012-04-11 | Last modified: | 2024-03-20 | Method: | X-RAY DIFFRACTION (2.2 Å) | Cite: | The mechanics behind DNA sequence-dependent properties of the nucleosome Nucleic Acids Res., 40, 2012
|
|
3C1B
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 3c1b by Molmil](/molmil-images/mine/3c1b) | The effect of H3 K79 dimethylation and H4 K20 trimethylation on nucleosome and chromatin structure | Descriptor: | Histone 2, H2bf, Histone H2A type 1, ... | Authors: | Lu, X, Simon, M, Chodaparambil, J, Hansen, J, Shokat, K, Luger, K. | Deposit date: | 2008-01-22 | Release date: | 2008-10-07 | Last modified: | 2023-11-15 | Method: | X-RAY DIFFRACTION (2.2 Å) | Cite: | The effect of H3K79 dimethylation and H4K20 trimethylation on nucleosome and chromatin structure. Nat.Struct.Mol.Biol., 15, 2008
|
|
4MZH
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 4mzh by Molmil](/molmil-images/mine/4mzh) | |
5CIU
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 5ciu by Molmil](/molmil-images/mine/5ciu) | Structural basis of the recognition of H3K36me3 by DNMT3B PWWP domain | Descriptor: | DNA (cytosine-5)-methyltransferase 3B, GLYCEROL, Histone H3.2 | Authors: | Rondelet, G, DAL MASO, T, Willems, L, Wouters, J. | Deposit date: | 2015-07-13 | Release date: | 2016-03-30 | Last modified: | 2024-01-10 | Method: | X-RAY DIFFRACTION (2.24 Å) | Cite: | Structural basis for recognition of histone H3K36me3 nucleosome by human de novo DNA methyltransferases 3A and 3B. J.Struct.Biol., 194, 2016
|
|