1FG0
 
 | | LARGE RIBOSOMAL SUBUNIT COMPLEXED WITH A 13 BP MINIHELIX-PUROMYCIN COMPOUND | | Descriptor: | 23S RIBOSOMAL RNA, 5'-R(CCGGCGGGCUGGUUCAAACCGGCCCGCCGGACC)-3'-5'-R(P-PUROMYCIN)-3' | | Authors: | Nissen, P, Hansen, J, Ban, N, Moore, P.B, Steitz, T.A. | | Deposit date: | 2000-07-26 | | Release date: | 2000-08-28 | | Last modified: | 2024-02-07 | | Method: | X-RAY DIFFRACTION (3 Å) | | Cite: | The structural basis of ribosome activity in peptide bond synthesis.
Science, 289, 2000
|
|
8RTZ
 | | The structure of E. coli penicillin binding protein 3 (PBP3) in complex with a bicyclic peptide inhibitor | | Descriptor: | 1,1',1''-(1,3,5-triazinane-1,3,5-triyl)tripropan-1-one, Bicyclic peptide inhibitor, Peptidoglycan D,D-transpeptidase FtsI | | Authors: | Newman, H, Rowland, C.E, Dods, R, Lewis, N, Stanway, S.J, Bellini, D, Beswick, P. | | Deposit date: | 2024-01-29 | | Release date: | 2024-04-03 | | Last modified: | 2024-10-23 | | Method: | X-RAY DIFFRACTION (1.52 Å) | | Cite: | Discovery and chemical optimisation of a Potent, Bi-cyclic (Bicycle) Antimicrobial Inhibitor of Escherichia coli PBP3
To Be Published
|
|
5EI6
 | | Rapid Discovery of Pyrido[3,4-d]pyrimidine Inhibitors of Monopolar Spindle kinase 1 (MPS1) Using a Structure-Based Hydridization Approach | | Descriptor: | DIMETHYL SULFOXIDE, Dual specificity protein kinase TTK, ~{N}-(2,4-dimethoxyphenyl)-5-(1-methylpyrazol-4-yl)isoquinolin-3-amine | | Authors: | Innocenti, P, Woodward, H.L, Solanki, S, Naud, N, Westwood, I.M, Cronin, N, Hayes, A, Roberts, J, Henley, A.T, Baker, R, Faisal, A, Mak, G, Box, G, Valenti, M, De Haven Brandon, A, O'Fee, L, Saville, J, Schmitt, J, Burke, R, van Montfort, R.L.M, Raymaud, F.I, Eccles, S.A, Linardopoulos, S, Blagg, J, Hoelder, S. | | Deposit date: | 2015-10-29 | | Release date: | 2016-04-20 | | Last modified: | 2024-05-08 | | Method: | X-RAY DIFFRACTION (2.01 Å) | | Cite: | Rapid Discovery of Pyrido[3,4-d]pyrimidine Inhibitors of Monopolar Spindle Kinase 1 (MPS1) Using a Structure-Based Hybridization Approach.
J.Med.Chem., 59, 2016
|
|
6H2U
 | | Crystal structure of human METTL5-TRMT112 complex, the 18S rRNA m6A1832 methyltransferase at 1.6A resolution | | Descriptor: | 1,2-ETHANEDIOL, Methyltransferase-like protein 5, Multifunctional methyltransferase subunit TRM112-like protein, ... | | Authors: | van Tran, N, Graille, M. | | Deposit date: | 2018-07-16 | | Release date: | 2019-07-31 | | Last modified: | 2019-09-18 | | Method: | X-RAY DIFFRACTION (1.6 Å) | | Cite: | The human 18S rRNA m6A methyltransferase METTL5 is stabilized by TRMT112.
Nucleic Acids Res., 47, 2019
|
|
6T8U
 | | Complement factor B in complex with 5-Bromo-3-chloro-N-(4,5-dihydro-1H-imidazol-2-yl)-7-methyl-1H-indol-4-amine | | Descriptor: | 5-bromanyl-3-chloranyl-~{N}-(1~{H}-imidazol-2-yl)-7-methyl-1~{H}-indol-4-amine, Complement factor B, SULFATE ION | | Authors: | Mainolfi, N, Ehara, T, Karki, R.G, Anderson, K, Mac Sweeney, A, Wiesmann, C, Adams, C, Liao, S.-M, Argikar, U.A, Jendza, K, Zhang, C, Powers, J, Klosowski, D.W, Crowley, M, Kawanami, T, Ding, J, April, M, Forster, C, Serrano-Wu, M, Capparelli, M, Ramqaj, R, Solovay, C, Cumin, F, Smith, T.M, Ferrara, L, Lee, W, Long, D, Prentiss, M, De Erkenez, A, Yang, L, Fang, L, Sellner, H, Sirockin, F, Valeur, E, Erbel, P, Ramage, P, Gerhartz, B, Schubart, A, Flohr, S, Gradoux, N, Feifel, R, Vogg, B, Maibaum, J, Eder, J, Sedrani, R, Harrison, R.A, Mogi, M, Jaffee, B.D, Adams, C.M. | | Deposit date: | 2019-10-25 | | Release date: | 2020-03-04 | | Last modified: | 2024-01-24 | | Method: | X-RAY DIFFRACTION (2.84 Å) | | Cite: | Discovery of 4-((2S,4S)-4-Ethoxy-1-((5-methoxy-7-methyl-1H-indol-4-yl)methyl)piperidin-2-yl)benzoic Acid (LNP023), a Factor B Inhibitor Specifically Designed To Be Applicable to Treating a Diverse Array of Complement Mediated Diseases.
J.Med.Chem., 63, 2020
|
|
6H13
 | | Crystal structure of TcACHE complexed to1-(4-((Methyl((1-(2-((1,2,3,4-tetrahydroacridin-9-yl)amino)ethyl)-1H-1,2,3-triazol-4-yl)methyl)amino)methyl)pyridin-2-yl)-3-(6-oxo-1,2,3,4,6,10b-hexahydropyrido[2,1-a]isoindol-10-yl)urea | | Descriptor: | 2-(N-MORPHOLINO)-ETHANESULFONIC ACID, 2-acetamido-2-deoxy-beta-D-glucopyranose, Acetylcholinesterase, ... | | Authors: | Coquelle, N, Colletier, J.P. | | Deposit date: | 2018-07-10 | | Release date: | 2019-05-15 | | Last modified: | 2024-01-17 | | Method: | X-RAY DIFFRACTION (2.8 Å) | | Cite: | Design, biological evaluation and X-ray crystallography of nanomolar multifunctional ligands targeting simultaneously acetylcholinesterase and glycogen synthase kinase-3.
Eur.J.Med.Chem., 168, 2019
|
|
5EHY
 | | Rapid Discovery of Pyrido[3,4-d]pyrimidine Inhibitors of Monopolar Spindle kinase 1 (MPS1) Using a Structure-Based Hydridization Approach | | Descriptor: | 1,2-ETHANEDIOL, 2-(2-(2-(2-(2-(2-ETHOXYETHOXY)ETHOXY)ETHOXY)ETHOXY)ETHOXY)ETHANOL, 4-(furan-3-yl)-3-phenyl-2~{H}-pyrazolo[4,3-c]pyridine, ... | | Authors: | Innocenti, P, Woodward, H.L, Solanki, S, Naud, N, Westwood, I.M, Cronin, N, Hayes, A, Roberts, J, Henley, A.T, Baker, R, Faisal, A, Mak, G, Box, G, Valenti, M, De Haven Brandon, A, O'Fee, L, Saville, J, Schmitt, J, Burke, R, van Montfort, R.L.M, Raymaud, F.I, Eccles, S.A, Linardopoulos, S, Blagg, J, Hoelder, S. | | Deposit date: | 2015-10-29 | | Release date: | 2016-04-20 | | Last modified: | 2024-05-08 | | Method: | X-RAY DIFFRACTION (2.26 Å) | | Cite: | Rapid Discovery of Pyrido[3,4-d]pyrimidine Inhibitors of Monopolar Spindle Kinase 1 (MPS1) Using a Structure-Based Hybridization Approach.
J.Med.Chem., 59, 2016
|
|
5EI8
 | | Rapid Discovery of Pyrido[3,4-d]pyrimidine Inhibitors of Monopolar Spindle kinase 1 (MPS1) Using a Structure-Based Hydridization Approach | | Descriptor: | DIMETHYL SULFOXIDE, Dual specificity protein kinase TTK, ~{N}-[2-methoxy-4-(1-methylpyrazol-4-yl)phenyl]-8-(1-methylpyrazol-4-yl)pyrido[3,4-d]pyrimidin-2-amine | | Authors: | Innocenti, P, Woodward, H.L, Solanki, S, Naud, N, Westwood, I.M, Cronin, N, Hayes, A, Roberts, J, Henley, A.T, Baker, R, Faisal, A, Mak, G, Box, G, Valenti, M, De Haven Brandon, A, O'Fee, L, Saville, J, Schmitt, J, Burke, R, van Montfort, R.L.M, Raymaud, F.I, Eccles, S.A, Linardopoulos, S, Blagg, J, Hoelder, S. | | Deposit date: | 2015-10-29 | | Release date: | 2016-04-20 | | Last modified: | 2024-05-08 | | Method: | X-RAY DIFFRACTION (2.17 Å) | | Cite: | Rapid Discovery of Pyrido[3,4-d]pyrimidine Inhibitors of Monopolar Spindle Kinase 1 (MPS1) Using a Structure-Based Hybridization Approach.
J.Med.Chem., 59, 2016
|
|
5TC4
 | | Crystal structure of human mitochondrial methylenetetrahydrofolate dehydrogenase-cyclohydrolase (MTHFD2) in complex with LY345899 and cofactors | | Descriptor: | 4-(7-AMINO-9-HYDROXY-1-OXO-3,3A,4,5-TETRAHYDRO-2,5,6,8,9B-PENTAAZA-CYCLOPENTA[A]NAPHTHALEN-2-YL)-PHENYLCARBONYL-GLUTAMI C ACID, Bifunctional methylenetetrahydrofolate dehydrogenase/cyclohydrolase, mitochondrial, ... | | Authors: | Gustafsson, R, Jemth, A.-S, Gustafsson Sheppard, N, Farnegardh, K, Loseva, O, Wiita, E, Bonagas, N, Dahllund, L, Llona-Minguez, S, Haggblad, M, Henriksson, M, Andersson, Y, Homan, E, Helleday, T, Stenmark, P. | | Deposit date: | 2016-09-14 | | Release date: | 2016-12-14 | | Last modified: | 2024-01-17 | | Method: | X-RAY DIFFRACTION (1.89 Å) | | Cite: | Crystal Structure of the Emerging Cancer Target MTHFD2 in Complex with a Substrate-Based Inhibitor.
Cancer Res., 77, 2017
|
|
5LGA
 | | Structural analysis and biological activities of BXL0124, a Gemini analog of Vitamin D | | Descriptor: | (1~{R},3~{S},5~{Z})-5-[2-[(1~{R},3~{a}~{S},7~{a}~{R})-7~{a}-methyl-1-[(6~{R})-1,1,1-tris(fluoranyl)-10-methyl-2,10-bis(oxidanyl)-2-(trifluoromethyl)undeca-3,8-diyn-6-yl]-2,3,3~{a},5,6,7-hexahydro-1~{H}-inden-4-ylidene]ethylidene]-4-methylidene-cyclohexane-1,3-diol, SRC-2, Vitamin D3 receptor A | | Authors: | Belorusova, A.Y, Rochel, N. | | Deposit date: | 2016-07-06 | | Release date: | 2016-10-19 | | Last modified: | 2024-01-10 | | Method: | X-RAY DIFFRACTION (2.5 Å) | | Cite: | Structural analysis and biological activities of BXL0124, a gemini analog of vitamin D.
J. Steroid Biochem. Mol. Biol., 173, 2017
|
|
6RZ4
 | | Crystal structure of cysteinyl leukotriene receptor 1 in complex with pranlukast | | Descriptor: | (2R)-2,3-dihydroxypropyl (9Z)-octadec-9-enoate, Cysteinyl leukotriene receptor 1,Soluble cytochrome b562,Cysteinyl leukotriene receptor 1, OLEIC ACID, ... | | Authors: | Luginina, A, Gusach, A, Marin, E, Mishin, A, Brouillette, R, Popov, P, Shiryaeva, A, Besserer-Offroy, E, Longpre, J.M, Lyapina, E, Ishchenko, A, Patel, N, Polovinkin, V, Safronova, N, Bogorodskiy, A, Edelweiss, E, Liu, W, Batyuk, A, Gordeliy, V, Han, G.W, Sarret, P, Katritch, V, Borshchevskiy, V, Cherezov, V. | | Deposit date: | 2019-06-12 | | Release date: | 2019-10-30 | | Last modified: | 2024-01-24 | | Method: | X-RAY DIFFRACTION (2.7 Å) | | Cite: | Structure-based mechanism of cysteinyl leukotriene receptor inhibition by antiasthmatic drugs.
Sci Adv, 5, 2019
|
|
4Z8A
 | | SH3-III of Drosophila Rim-binding protein bound to a Cacophony derived peptide | | Descriptor: | RIM-binding protein, isoform F, Voltage-dependent calcium channel type A subunit alpha-1 | | Authors: | Driller, J.H, Holton, N, Siebert, M, Boehme, A.M, Wahl, M.C, Sigrist, S.J, Loll, B. | | Deposit date: | 2015-04-08 | | Release date: | 2015-08-05 | | Last modified: | 2024-01-10 | | Method: | X-RAY DIFFRACTION (1.759 Å) | | Cite: | A high affinity RIM-binding protein/Aplip1 interaction prevents the formation of ectopic axonal active zones.
Elife, 4, 2015
|
|
5O6O
 | | 17beta-hydroxysteroid dehydrogenase 14 variant T205 in complex with a non-steroidal 2,6-pyridinketone inhibitor | | Descriptor: | 17-beta-hydroxysteroid dehydrogenase 14, 2-fluoranyl-3-[6-(4-fluoranyl-3-oxidanyl-phenoxy)pyridin-2-yl]phenol, NICOTINAMIDE-ADENINE-DINUCLEOTIDE, ... | | Authors: | Bertoletti, N, Heine, A, Braun, F, Klebe, G, Marchais-Oberwinkler, S. | | Deposit date: | 2017-06-07 | | Release date: | 2018-06-06 | | Last modified: | 2024-01-17 | | Method: | X-RAY DIFFRACTION (1.45 Å) | | Cite: | Structure-based design and profiling of novel 17 beta-HSD14 inhibitors.
Eur J Med Chem, 155, 2018
|
|
1KUH
 | | ZINC PROTEASE FROM STREPTOMYCES CAESPITOSUS | | Descriptor: | CALCIUM ION, ZINC ION, ZINC PROTEASE | | Authors: | Kurisu, G, Kinoshita, T, Sugimoto, A, Nagara, A, Kai, Y, Kasai, N, Harada, S. | | Deposit date: | 1996-02-22 | | Release date: | 1997-03-12 | | Last modified: | 2024-10-23 | | Method: | X-RAY DIFFRACTION (1.6 Å) | | Cite: | Structure of the zinc endoprotease from Streptomyces caespitosus.
J.Biochem.(Tokyo), 121, 1997
|
|
6H12
 | | Crystal structure of TcACHE complexed to 1-(6-Oxo-1,2,3,4,6,10b-hexahydropyrido[2,1-a]isoindol-10-yl)-3-(4-(((1-(2-((1,2,3,4-tetrahydroacridin-9-yl)amino)ethyl)-1H-1,2,3-triazol-4-yl)methoxy)methyl)pyridin-2-yl)urea | | Descriptor: | 1,2-ETHANEDIOL, 1-[4-[[1-[2-(1,2,3,4,4~{a},9~{a}-hexahydroacridin-9-ylamino)ethyl]-1,2,3-triazol-4-yl]methoxymethyl]pyridin-2-yl]-3-[(10~{b}~{R})-6-oxidanylidene-2,3,4,10~{b}-tetrahydro-1~{H}-pyrido[2,1-a]isoindol-10-yl]urea, 2-(N-MORPHOLINO)-ETHANESULFONIC ACID, ... | | Authors: | Coquelle, N, Colletier, J.P. | | Deposit date: | 2018-07-10 | | Release date: | 2019-05-15 | | Last modified: | 2024-10-23 | | Method: | X-RAY DIFFRACTION (2.2 Å) | | Cite: | Design, biological evaluation and X-ray crystallography of nanomolar multifunctional ligands targeting simultaneously acetylcholinesterase and glycogen synthase kinase-3.
Eur.J.Med.Chem., 168, 2019
|
|
6H3M
 | |
5FAH
 | | KALLIKREIN-7 IN COMPLEX WITH COMPOUND1 | | Descriptor: | (2~{S})-~{N}2-[2-(4-methoxyphenyl)ethyl]-~{N}1-(naphthalen-1-ylmethyl)pyrrolidine-1,2-dicarboxamide, ACETATE ION, Kallikrein-7 | | Authors: | Ostermann, N, Zink, F. | | Deposit date: | 2015-12-11 | | Release date: | 2016-10-26 | | Last modified: | 2024-01-10 | | Method: | X-RAY DIFFRACTION (1.1 Å) | | Cite: | Small-molecule factor D inhibitors targeting the alternative complement pathway.
Nat.Chem.Biol., 12, 2016
|
|
7CRZ
 | | Crystal structure of human glucose transporter GLUT3 bound with C3361 | | Descriptor: | (2R)-2,3-dihydroxypropyl (9Z)-octadec-9-enoate, (2S,3R,4S,5R,6R)-6-(hydroxymethyl)-4-undec-10-enoxy-oxane-2,3,5-triol, Solute carrier family 2, ... | | Authors: | Yuan, Y.Y, Zhang, S, Wang, N, Jiang, X, Yan, N. | | Deposit date: | 2020-08-14 | | Release date: | 2021-01-13 | | Last modified: | 2023-11-29 | | Method: | X-RAY DIFFRACTION (2.3 Å) | | Cite: | Orthosteric-allosteric dual inhibitors of PfHT1 as selective antimalarial agents.
Proc.Natl.Acad.Sci.USA, 118, 2021
|
|
5O43
 | | 17beta-hydroxysteroid dehydrogenase 14 variant T205 in complex with a non-steroidal 2,6-pyridinketone inhibitor. | | Descriptor: | 17-beta-hydroxysteroid dehydrogenase 14, 2-fluoranyl-3-[6-[(4-fluoranyl-3-oxidanyl-phenyl)-methyl-amino]pyridin-2-yl]phenol, NICOTINAMIDE-ADENINE-DINUCLEOTIDE, ... | | Authors: | Bertoletti, N, Heine, A, Braun, F, Klebe, G, Marchais-Oberwinkler, S. | | Deposit date: | 2017-05-25 | | Release date: | 2018-06-06 | | Last modified: | 2024-01-17 | | Method: | X-RAY DIFFRACTION (1.5 Å) | | Cite: | Structure-based design and profiling of novel 17 beta-HSD14 inhibitors.
Eur J Med Chem, 155, 2018
|
|
5O7C
 | | 17beta-hydroxysteroid dehydrogenase 14 variant T205 in complex with a non-steroidal quinoline based inhibitor | | Descriptor: | 17-beta-hydroxysteroid dehydrogenase 14, 2-(4-fluoranyl-3-oxidanyl-phenyl)carbonylquinoline-7-carbonitrile, NICOTINAMIDE-ADENINE-DINUCLEOTIDE, ... | | Authors: | Bertoletti, N, Braun, F, Heine, A, Klebe, G, Marchais-Oberwinkler, S. | | Deposit date: | 2017-06-08 | | Release date: | 2018-06-06 | | Last modified: | 2024-01-17 | | Method: | X-RAY DIFFRACTION (1.6 Å) | | Cite: | Structure-based design and profiling of novel 17 beta-HSD14 inhibitors.
Eur J Med Chem, 155, 2018
|
|
5OEO
 | | Solution structure of the complex of TRPV5(655-725) with a Calmodulin E32Q/E68Q double mutant | | Descriptor: | CALCIUM ION, Calmodulin-1, Transient receptor potential cation channel subfamily V member 5 | | Authors: | Vuister, G.W, Bokhovchuk, F.M, Bate, N, Kovalevskaya, N, Goult, B.T, Spronk, C.A.E.M. | | Deposit date: | 2017-07-09 | | Release date: | 2018-04-25 | | Last modified: | 2024-05-15 | | Method: | SOLUTION NMR | | Cite: | The Structural Basis of Calcium-Dependent Inactivation of the Transient Receptor Potential Vanilloid 5 Channel.
Biochemistry, 57, 2018
|
|
1GEH
 | | CRYSTAL STRUCTURE OF ARCHAEAL RUBISCO (RIBULOSE 1,5-BISPHOSPHATE CARBOXYLASE/OXYGENASE) | | Descriptor: | RIBULOSE-1,5-BISPHOSPHATE CARBOXYLASE/OXYGENASE, SULFATE ION | | Authors: | Kitano, K, Maeda, N, Fukui, T, Atomi, H, Imanaka, T, Miki, K. | | Deposit date: | 2000-11-13 | | Release date: | 2001-12-19 | | Last modified: | 2023-12-27 | | Method: | X-RAY DIFFRACTION (2.8 Å) | | Cite: | Crystal Structure of a Novel-Type Archaeal Rubisco with Pentagonal Symmetry
Structure, 9, 2001
|
|
5X7R
 | | Crystal structure of Paenibacillus sp. 598K alpha-1,6-glucosyltransferase complexed with isomaltohexaose | | Descriptor: | 1,2-ETHANEDIOL, 2-(N-MORPHOLINO)-ETHANESULFONIC ACID, 4,6-dideoxy-4-{[(1S,4R,5S,6S)-4,5,6-trihydroxy-3-(hydroxymethyl)cyclohex-2-en-1-yl]amino}-alpha-D-glucopyranose-(1-4)-alpha-D-glucopyranose, ... | | Authors: | Fujimoto, Z, Kishine, N, Suzuki, N, Momma, M, Ichinose, H, Kimura, A, Funane, K. | | Deposit date: | 2017-02-27 | | Release date: | 2017-07-26 | | Last modified: | 2023-11-22 | | Method: | X-RAY DIFFRACTION (1.95 Å) | | Cite: | Carbohydrate-binding architecture of the multi-modular alpha-1,6-glucosyltransferase from Paenibacillus sp. 598K, which produces alpha-1,6-glucosyl-alpha-glucosaccharides from starch
Biochem. J., 474, 2017
|
|
6HDW
 | | Crystal structure of 2-Hydroxyisobutyryl-CoA Ligase (HCL) in the postadenylation state in complex with 2-HIB-AMP | | Descriptor: | 2-hydroxyisobutyryl-CoA synthetase, SULFATE ION, [[(2~{R},3~{S},4~{R},5~{R})-5-(6-aminopurin-9-yl)-3,4-bis(oxidanyl)oxolan-2-yl]methoxy-oxidanyl-phosphoryl] 2-methyl-2-oxidanyl-propanoate | | Authors: | Zahn, M, Rohwerder, T, Strater, N. | | Deposit date: | 2018-08-20 | | Release date: | 2019-08-28 | | Last modified: | 2024-01-17 | | Method: | X-RAY DIFFRACTION (2.3 Å) | | Cite: | Structures of 2-Hydroxyisobutyric Acid-CoA Ligase Reveal Determinants of Substrate Specificity and Describe a Multi-Conformational Catalytic Cycle.
J.Mol.Biol., 431, 2019
|
|
6HR2
 | | Crystal structure of PROTAC 2 in complex with the bromodomain of human SMARCA4 and pVHL:ElonginC:ElonginB | | Descriptor: | (2~{S},4~{R})-~{N}-[[2-[2-[4-[[4-[3-azanyl-6-(2-hydroxyphenyl)pyridazin-4-yl]piperazin-1-yl]methyl]phenyl]ethoxy]-4-(4-methyl-1,3-thiazol-5-yl)phenyl]methyl]-1-[(2~{S})-2-[(1-fluoranylcyclopropyl)carbonylamino]-3,3-dimethyl-butanoyl]-4-oxidanyl-pyrrolidine-2-carboxamide, 1,2-ETHANEDIOL, DIMETHYL SULFOXIDE, ... | | Authors: | Roy, M, Bader, G, Diers, E, Trainor, N, Farnaby, W, Ciulli, A. | | Deposit date: | 2018-09-26 | | Release date: | 2019-06-12 | | Last modified: | 2024-05-15 | | Method: | X-RAY DIFFRACTION (1.76 Å) | | Cite: | BAF complex vulnerabilities in cancer demonstrated via structure-based PROTAC design.
Nat.Chem.Biol., 15, 2019
|
|
