7RKK
| Structure of Nicotinamide N-Methyltransferase (NNMT) in complex with II399 (C2 space group) | Descriptor: | 3-[3-(acetyl{[(1R,2R,3S,4R)-4-(4-chloro-7H-pyrrolo[2,3-d]pyrimidin-7-yl)-2,3-dihydroxycyclopentyl]methyl}amino)prop-1-yn-1-yl]benzamide, NNMT protein | Authors: | Yadav, R, Noinaj, N, Iyamu, I.D, Huang, R. | Deposit date: | 2021-07-22 | Release date: | 2022-07-20 | Last modified: | 2023-10-18 | Method: | X-RAY DIFFRACTION (2.76 Å) | Cite: | Exploring Unconventional SAM Analogues To Build Cell-Potent Bisubstrate Inhibitors for Nicotinamide N-Methyltransferase. Angew.Chem.Int.Ed.Engl., 61, 2022
|
|
8T4N
| |
7YM0
| Lysoplasmalogen-specific phospholipase D (LyPls-PLD) with Ca2+ | Descriptor: | CALCIUM ION, Lysoplasmalogenase | Authors: | Yasutake, Y, Sakasegawa, S, Sugimori, D, Murayama, K. | Deposit date: | 2022-07-27 | Release date: | 2023-01-04 | Method: | X-RAY DIFFRACTION (2.91 Å) | Cite: | Structural basis for the substrate specificity switching of lysoplasmalogen-specific phospholipase D from Thermocrispum sp. RD004668. Biosci.Biotechnol.Biochem., 87, 2022
|
|
8G7X
| Human fatty acid synthase dehydratase domain | Descriptor: | 3-hydroxyacyl-[acyl-carrier-protein] dehydratase, ACETATE ION, DIMETHYL SULFOXIDE, ... | Authors: | Akey, D.L, Konwerski, J.R, McCullough, T.M, Smith, J.L. | Deposit date: | 2023-02-17 | Release date: | 2023-06-07 | Last modified: | 2023-09-20 | Method: | X-RAY DIFFRACTION (1.815 Å) | Cite: | Structure of a modular polyketide synthase reducing region. Structure, 31, 2023
|
|
7UHC
| |
6X4Q
| Human cyclophilin A bound to a series of acylcic and macrocyclic inhibitors: (2R,5S,11S,14S,18E)-14-cyclobutyl-2,11,17,17-tetramethyl-15-oxa-3,9,12,26,29-pentaazatetracyclo[18.5.3.1~5,9~.0~23,27~]nonacosa-1(25),18,20(28),21,23,26-hexaene-4,10,13,16-tetrone (compound 33) | Descriptor: | (2R,5S,11S,14S,18E)-14-cyclobutyl-2,11,17,17-tetramethyl-15-oxa-3,9,12,26,29-pentaazatetracyclo[18.5.3.1~5,9~.0~23,27~]nonacosa-1(25),18,20(28),21,23,26-hexaene-4,10,13,16-tetrone, Peptidyl-prolyl cis-trans isomerase A | Authors: | Appleby, T.C, Paulsen, J.L, Schmitz, U, Shivakumar, D. | Deposit date: | 2020-05-22 | Release date: | 2020-06-24 | Last modified: | 2023-10-18 | Method: | X-RAY DIFFRACTION (1.8 Å) | Cite: | Evaluation of Free Energy Calculations for the Prioritization of Macrocycle Synthesis. J.Chem.Inf.Model., 60, 2020
|
|
5E3M
| Crystal structure of Fis bound to 27bp DNA F35 (AAATTAGTTTGAATCTCGAGCTAATTT) | Descriptor: | DNA (27-MER), DNA-binding protein Fis | Authors: | Stella, S, Hancock, S.P, Cascio, D, Johnson, R.C. | Deposit date: | 2015-10-03 | Release date: | 2016-03-09 | Last modified: | 2024-05-22 | Method: | X-RAY DIFFRACTION (2.886 Å) | Cite: | DNA Sequence Determinants Controlling Affinity, Stability and Shape of DNA Complexes Bound by the Nucleoid Protein Fis. Plos One, 11, 2016
|
|
8GI7
| |
8GM9
| Structure of Citrate Synthase(CitA) in Mycobacterium Tuberculosis | Descriptor: | 1,2-ETHANEDIOL, ACRYLIC ACID, DI(HYDROXYETHYL)ETHER, ... | Authors: | Pathirage, R, Ronning, D, Favrot, L. | Deposit date: | 2023-03-24 | Release date: | 2023-06-07 | Last modified: | 2023-11-08 | Method: | X-RAY DIFFRACTION (2.4 Å) | Cite: | Mycobacterium tuberculosis CitA activity is modulated by cysteine oxidation and pyruvate binding. Rsc Med Chem, 14, 2023
|
|
8GLL
| R149E variant of Citrate Synthase (CitA) in Mycobacterium tuberculosis | Descriptor: | 1,2-ETHANEDIOL, DI(HYDROXYETHYL)ETHER, SULFATE ION, ... | Authors: | Pathirage, R, Ronning, D, Petit, C. | Deposit date: | 2023-03-22 | Release date: | 2023-06-07 | Last modified: | 2023-11-08 | Method: | X-RAY DIFFRACTION (2.65 Å) | Cite: | Mycobacterium tuberculosis CitA activity is modulated by cysteine oxidation and pyruvate binding. Rsc Med Chem, 14, 2023
|
|
5S9L
| AUTOTAXIN, 4-[3-Oxo-3-(2-oxo-2,3-dihydro-benzooxazol-6-yl)-propyl]-piperazine-1-carboxylic acid 3,5-dichloro-benzyl ester, 1.90A, P212121, Rfree=19.1% | Descriptor: | (3,5-dichlorophenyl)methyl 4-[3-oxo-3-(2-oxo-2,3-dihydro-1,3-benzoxazol-6-yl)propyl]piperazine-1-carboxylate, ACETATE ION, CALCIUM ION, ... | Authors: | Stihle, M, Hunziker, D, Benz, J, Mattei, P, Rudolph, M.G. | Deposit date: | 2021-03-31 | Release date: | 2022-04-13 | Last modified: | 2024-04-03 | Method: | X-RAY DIFFRACTION (1.9 Å) | Cite: | Crystal Structure of a rat Autotaxin complex To be published
|
|
6EIE
| |
7V7Z
| Cryo-EM structure of SARS-CoV-2 S-Beta variant (B.1.351) in complex with Angiotensin-converting enzyme 2 (ACE2) ectodomain, three ACE2-bound form | Descriptor: | 2-acetamido-2-deoxy-beta-D-glucopyranose, 2-acetamido-2-deoxy-beta-D-glucopyranose-(1-4)-2-acetamido-2-deoxy-beta-D-glucopyranose, Angiotensin-converting enzyme 2,Green fluorescent protein, ... | Authors: | Yang, T.J, Yu, P.Y, Chang, Y.C, Hsu, S.T.D. | Deposit date: | 2021-08-22 | Release date: | 2021-10-06 | Method: | ELECTRON MICROSCOPY (3.1 Å) | Cite: | Cryo-EM structure of SARS-CoV-2 S-Beta variant (B.1.351) in complex with Angiotensin-converting enzyme 2 (ACE2) ectodomain, three ACE2-bound form To Be Published
|
|
5S9M
| AUTOTAXIN, (3,5-dichlorophenyl)methyl (3aS,8aR)-2-(1H-benzotriazole-5-carbonyl)-1,3,3a,4,5,7,8,8a-octahydropyrrolo[3,4-d]azepine-6-carboxylate, 1.80A, P212121, Rfree=21.1% | Descriptor: | (3,5-dichlorophenyl)methyl (3aR,8aS)-2-(1H-benzotriazole-5-carbonyl)octahydropyrrolo[3,4-d]azepine-6(1H)-carboxylate, ACETATE ION, CALCIUM ION, ... | Authors: | Stihle, M, Hunziker, D, Benz, J, Mattei, P, Rudolph, M.G. | Deposit date: | 2021-03-31 | Release date: | 2022-04-13 | Last modified: | 2024-04-03 | Method: | X-RAY DIFFRACTION (1.8 Å) | Cite: | Crystal Structure of a rat Autotaxin complex To be published
|
|
8GIW
| |
8GMF
| |
5S9N
| AUTOTAXIN, [4-(trifluoromethoxy)phenyl]methyl (3aS,6aS)-2-(1H-benzotriazole-5-carbonyl)-1,3,3a,4,6,6a-hexahydropyrrolo[3,4-c]pyrrole-5-carboxylate, 1.80A, P212121, Rfree=23.3% | Descriptor: | CALCIUM ION, CHLORIDE ION, Isoform 2 of Ectonucleotide pyrophosphatase/phosphodiesterase family member 2, ... | Authors: | Stihle, M, Hunziker, D, Benz, J, Mattei, P, Rudolph, M.G. | Deposit date: | 2021-03-31 | Release date: | 2022-04-13 | Last modified: | 2024-04-03 | Method: | X-RAY DIFFRACTION (1.8 Å) | Cite: | Crystal Structure of a rat Autotaxin complex To be published
|
|
7REG
| DfrA1 complexed with NADPH and 4'-chloro-3'-(4-(2,4-diamino-6-ethylpyrimidin-5-yl)but-3-yn-2-yl)-[1,1'-biphenyl]-4-carboxamide (UCP1228) | Descriptor: | 4'-chloro-3'-[(2S)-4-(2,4-diamino-6-ethylpyrimidin-5-yl)but-3-yn-2-yl][1,1'-biphenyl]-4-carboxamide, CALCIUM ION, Dihydrofolate reductase type 1, ... | Authors: | Lombardo, M.N, Wright, D.L. | Deposit date: | 2021-07-12 | Release date: | 2022-07-27 | Last modified: | 2023-10-18 | Method: | X-RAY DIFFRACTION (1.77 Å) | Cite: | Structure-guided functional studies of plasmid-encoded dihydrofolate reductases reveal a common mechanism of trimethoprim resistance in Gram-negative pathogens. Commun Biol, 5, 2022
|
|
7P80
| Crystal structure of ClpP from Bacillus subtilis in complex with ADEP2 (compressed state) | Descriptor: | ADEP2, ATP-dependent Clp protease proteolytic subunit | Authors: | Lee, B.-G, Kim, L, Kim, M.K, Kwon, D.H, Song, H.K. | Deposit date: | 2021-07-21 | Release date: | 2022-06-29 | Last modified: | 2024-01-31 | Method: | X-RAY DIFFRACTION (2.98 Å) | Cite: | Structural insights into ClpP protease side exit pore-opening by a pH drop coupled with substrate hydrolysis. Embo J., 41, 2022
|
|
6LNH
| Crystal structure of IDO from Bacillus thuringiensis | Descriptor: | FE (III) ION, L-isoleucine-4-hydroxylase, MERCURY (II) ION | Authors: | Feng, Y, Huang, J.W, Liu, W.D, Chen, C.C, Guo, R.T. | Deposit date: | 2019-12-30 | Release date: | 2021-01-13 | Last modified: | 2023-10-25 | Method: | X-RAY DIFFRACTION (2.34 Å) | Cite: | Crystal structure of IDO from Bacillus thuringiensis to be published
|
|
5L3G
| LSD1-CoREST1 in complex with polymyxin E (colistin) | Descriptor: | FLAVIN-ADENINE DINUCLEOTIDE, Lysine-specific histone demethylase 1A, REST corepressor 1, ... | Authors: | Speranzini, V, Rotili, D, Ciossani, G, Pilotto, S, Forgione, M, Lucidi, A, Forneris, F, Velankar, S, Mai, A, Mattevi, A. | Deposit date: | 2016-04-10 | Release date: | 2016-09-21 | Last modified: | 2024-01-10 | Method: | X-RAY DIFFRACTION (3.1 Å) | Cite: | Polymyxins and quinazolines are LSD1/KDM1A inhibitors with unusual structural features. Sci Adv, 2, 2016
|
|
7MJC
| Crystal Structure Analysis of ALDH1B1 | Descriptor: | Aldehyde dehydrogenase X, mitochondrial, NICOTINAMIDE-ADENINE-DINUCLEOTIDE, ... | Authors: | Fernandez, D, Chen, J.K. | Deposit date: | 2021-04-20 | Release date: | 2022-06-08 | Last modified: | 2023-10-18 | Method: | X-RAY DIFFRACTION (2.68 Å) | Cite: | Inhibitors targeted to aldehyde dehydrogenase Nat.Chem.Biol., 2022
|
|
6ZR8
| |
7MJD
| Crystal Structure Analysis of ALDH1B1 | Descriptor: | 8-(2-methoxyphenyl)-10-(4-phenylphenyl)-1$l^{4},8-diazabicyclo[5.3.0]deca-1(7),9-diene, Aldehyde dehydrogenase X, mitochondrial, ... | Authors: | Fernandez, D, Chen, J.K. | Deposit date: | 2021-04-20 | Release date: | 2022-06-08 | Last modified: | 2023-10-18 | Method: | X-RAY DIFFRACTION (2.12 Å) | Cite: | Inhibitors targeted to aldehyde dehydrogenase Nat.Chem.Biol., 2022
|
|
6WWA
| Crystal structure of human SHLD2-SHLD3-REV7 complex | Descriptor: | Mitotic spindle assembly checkpoint protein MAD2B, Shieldin complex subunit 2,Shieldin complex subunit 3 chimera | Authors: | Xie, W, Patel, D.J. | Deposit date: | 2020-05-08 | Release date: | 2021-03-03 | Last modified: | 2023-10-18 | Method: | X-RAY DIFFRACTION (3.8 Å) | Cite: | Molecular mechanisms of assembly and TRIP13-mediated remodeling of the human Shieldin complex. Proc.Natl.Acad.Sci.USA, 118, 2021
|
|