PDB: 2037 resultsInfo pagesStatus searchChemie searchBIRD

---

8SMN	Xenopus laevis hyaluronan synthase 1, nascent HA polymer bound state Descriptor: 2-acetamido-2-deoxy-beta-D-glucopyranose-(1-4)-beta-D-glucopyranuronic acid-(1-3)-2-acetamido-2-deoxy-beta-D-glucopyranose-(1-4)-beta-D-glucopyranuronic acid-(1-3)-2-acetamido-2-deoxy-beta-D-glucopyranose-(1-4)-beta-D-glucopyranuronic acid-(1-3)-2-acetamido-2-deoxy-beta-D-glucopyranose-(1-4)-beta-D-glucopyranuronic acid-(1-3)-2-acetamido-2-deoxy-beta-D-glucopyranose, Fab15 heavy chain, Fab15 light chain, ... Authors: Gorniak, I, Zimmer, J. Deposit date: 2023-04-26 Release date: 2024-05-01 Method: ELECTRON MICROSCOPY (3.2 Å) Cite: Atomistic insights into hyaluronan synthesis, secretion, and length control To Be Published
8T8N	Venezuelan Equine Encephalitis Virus (VEEV) Nonstructural Protein 2 (nsP2) Cysteine Protease Inhibited with CA074 Descriptor: Protease nsP2, [PROPYLAMINO-3-HYDROXY-BUTAN-1,4-DIONYL]-ISOLEUCYL-PROLINE Authors: Compton, J.R, Legler, P.M. Deposit date: 2023-06-22 Release date: 2023-08-09 Method: X-RAY DIFFRACTION (2.32 Å) Cite: In Silico Screening of Inhibitors of the Venezuelan Equine Encephalitis Virus Nonstructural Protein 2 Cysteine Protease. Viruses, 15, 2023
4W4O	High-resolution crystal structure of Fc bound to its human receptor Fc-gamma-RI Descriptor: 2-acetamido-2-deoxy-beta-D-glucopyranose-(1-4)-2-acetamido-2-deoxy-beta-D-glucopyranose, ACETATE ION, GLYCEROL, ... Authors: Caaveiro, J.M.M, Kiyoshi, M, Tsumoto, K. Deposit date: 2014-08-15 Release date: 2015-04-29 Last modified: 2023-11-08 Method: X-RAY DIFFRACTION (1.8 Å) Cite: Structural basis for binding of human IgG1 to its high-affinity human receptor Fc gamma RI Nat Commun, 6, 2015
2KZS	DAXX helical bundle (DHB) domain Descriptor: Death-associated protein 6 Authors: Escobar-Cabrera, E, Lau, D.K.W, Giovinazzi, S, Ishov, A.M, McIntosh, L.P. Deposit date: 2010-06-23 Release date: 2010-12-15 Last modified: 2024-05-15 Method: SOLUTION NMR Cite: Structural Characterization of the DAXX N-Terminal Helical Bundle Domain and Its Complex with Rassf1C. Structure, 18, 2010
8HFR	NPC-trapped pre-60S particle Descriptor: 25S ribosomal RNA, 5.8S ribosomal RNA, 5S ribosomal RNA, ... Authors: Li, Z.Q, Chen, S.J, Sui, S.F. Deposit date: 2022-11-12 Release date: 2023-04-12 Last modified: 2023-06-28 Method: ELECTRON MICROSCOPY (2.64 Å) Cite: Nuclear export of pre-60S particles through the nuclear pore complex. Nature, 618, 2023
2MFU	Solution NMR structure of quadruplex d(TGGGTTTGGGTTGGGTTTGGG) in sodium conditions Descriptor: 5'-D(*TP*GP*GP*GP*TP*TP*TP*GP*GP*GP*TP*TP*GP*GP*GP*TP*TP*TP*GP*GP*G)-3' Authors: Karsisiotis, A, Dillon, P, Webba da Silva, M. Deposit date: 2013-10-23 Release date: 2014-10-29 Last modified: 2024-05-01 Method: SOLUTION NMR Cite: Solution NMR structure of quadruplex d(TGGGTTTGGGTTGGGTTTGGG) in sodium conditions To be Published
2MNY	NMR Structure of KDM5B PHD1 finger Descriptor: Lysine-specific demethylase 5B, ZINC ION Authors: Zhang, Y, Yang, H.R, Guo, X, Rong, N.Y, Song, Y.J, Xu, Y.W, Lan, W.X, Xu, Y.H, Cao, C. Deposit date: 2014-04-16 Release date: 2014-08-06 Last modified: 2024-05-15 Method: SOLUTION NMR Cite: The PHD1 finger of KDM5B recognizes unmodified H3K4 during the demethylation of histone H3K4me2/3 by KDM5B. Protein Cell, 5, 2014
2M6W	Solution NMR structure of the d(GGGGTTGGGGTTTTGGGGAAGGGG) quadruplex in sodium conditions Descriptor: DNA (5'-D(*GP*GP*GP*GP*TP*TP*GP*GP*GP*GP*TP*TP*TP*TP*GP*GP*GP*GP*AP*AP*GP*GP*GP*G)-3') Authors: Karsisiotis, A.I, Webba da Silva, M. Deposit date: 2013-04-19 Release date: 2014-07-23 Last modified: 2024-05-15 Method: SOLUTION NMR Cite: Encoding canonical DNA quadruplex structure. Sci Adv, 4, 2018
2MNZ	NMR Structure of KDM5B PHD1 finger in complex with H3K4me0(1-10aa) Descriptor: H3K4me0, Lysine-specific demethylase 5B, ZINC ION Authors: Zhang, Y, Yang, H.R, Guo, X, Rong, N.Y, Song, Y.J, Xu, Y.W, Lan, W.X, Xu, Y.H, Cao, C. Deposit date: 2014-04-16 Release date: 2014-08-06 Last modified: 2024-05-15 Method: SOLUTION NMR Cite: The PHD1 finger of KDM5B recognizes unmodified H3K4 during the demethylation of histone H3K4me2/3 by KDM5B. Protein Cell, 5, 2014
5NSL	Structure of D80A-fructofuranosidase from Xanthophyllomyces dendrorhous complexed with fructose and hydroxytyrosol Descriptor: 1,2-ETHANEDIOL, 2-acetamido-2-deoxy-beta-D-glucopyranose, 2-acetamido-2-deoxy-beta-D-glucopyranose-(1-4)-2-acetamido-2-deoxy-beta-D-glucopyranose, ... Authors: Ramirez-Escudero, M, Sanz-Aparicio, J. Deposit date: 2017-04-26 Release date: 2018-11-07 Last modified: 2024-01-17 Method: X-RAY DIFFRACTION (1.7 Å) Cite: Fructosylation of Hydroxytyrosol by the Beta-Fructofuranosidase from Xanthophyllomyces dendrorhous: Insights into the Molecular Basis of the Enzyme Specificity Chemcatchem, 2018
5O4Y	Structure of human PD-L1 in complex with inhibitor Descriptor: PHE-MAA-ASN-PRO-HIS-LEU-SER-TRP-SER-TRP-9KK-9KK-ARG-CCS-GLY-NH2, Programmed cell death 1 ligand 1 Authors: Magiera, K, Grudnik, P, Dubin, G, Holak, T.A. Deposit date: 2017-05-31 Release date: 2017-09-20 Last modified: 2024-01-17 Method: X-RAY DIFFRACTION (2.3 Å) Cite: Bioactive Macrocyclic Inhibitors of the PD-1/PD-L1 Immune Checkpoint. Angew. Chem. Int. Ed. Engl., 56, 2017
5O45	Structure of human PD-L1 in complex with inhibitor Descriptor: PHE-MEA-9KK-SAR-ASP-VAL-MEA-TYR-SAR-TRP-TYR-LEU-CCS-GLY-NH2, Programmed cell death 1 ligand 1 Authors: Magiera, K, Grudnik, P, Dubin, G, Holak, T.A. Deposit date: 2017-05-26 Release date: 2017-09-20 Last modified: 2024-01-17 Method: X-RAY DIFFRACTION (0.99 Å) Cite: Bioactive Macrocyclic Inhibitors of the PD-1/PD-L1 Immune Checkpoint. Angew. Chem. Int. Ed. Engl., 56, 2017
5S9L	AUTOTAXIN, 4-[3-Oxo-3-(2-oxo-2,3-dihydro-benzooxazol-6-yl)-propyl]-piperazine-1-carboxylic acid 3,5-dichloro-benzyl ester, 1.90A, P212121, Rfree=19.1% Descriptor: (3,5-dichlorophenyl)methyl 4-[3-oxo-3-(2-oxo-2,3-dihydro-1,3-benzoxazol-6-yl)propyl]piperazine-1-carboxylate, ACETATE ION, CALCIUM ION, ... Authors: Stihle, M, Hunziker, D, Benz, J, Mattei, P, Rudolph, M.G. Deposit date: 2021-03-31 Release date: 2022-04-13 Last modified: 2024-04-03 Method: X-RAY DIFFRACTION (1.9 Å) Cite: Crystal Structure of a rat Autotaxin complex To be published
5S9M	AUTOTAXIN, (3,5-dichlorophenyl)methyl (3aS,8aR)-2-(1H-benzotriazole-5-carbonyl)-1,3,3a,4,5,7,8,8a-octahydropyrrolo[3,4-d]azepine-6-carboxylate, 1.80A, P212121, Rfree=21.1% Descriptor: (3,5-dichlorophenyl)methyl (3aR,8aS)-2-(1H-benzotriazole-5-carbonyl)octahydropyrrolo[3,4-d]azepine-6(1H)-carboxylate, ACETATE ION, CALCIUM ION, ... Authors: Stihle, M, Hunziker, D, Benz, J, Mattei, P, Rudolph, M.G. Deposit date: 2021-03-31 Release date: 2022-04-13 Last modified: 2024-04-03 Method: X-RAY DIFFRACTION (1.8 Å) Cite: Crystal Structure of a rat Autotaxin complex To be published
5S9N	AUTOTAXIN, [4-(trifluoromethoxy)phenyl]methyl (3aS,6aS)-2-(1H-benzotriazole-5-carbonyl)-1,3,3a,4,6,6a-hexahydropyrrolo[3,4-c]pyrrole-5-carboxylate, 1.80A, P212121, Rfree=23.3% Descriptor: CALCIUM ION, CHLORIDE ION, Isoform 2 of Ectonucleotide pyrophosphatase/phosphodiesterase family member 2, ... Authors: Stihle, M, Hunziker, D, Benz, J, Mattei, P, Rudolph, M.G. Deposit date: 2021-03-31 Release date: 2022-04-13 Last modified: 2024-04-03 Method: X-RAY DIFFRACTION (1.8 Å) Cite: Crystal Structure of a rat Autotaxin complex To be published
5KKB	Structure of mouse Golgi alpha-1,2-mannosidase IA and Man9GlcNAc2-PA complex Descriptor: 1,4-BUTANEDIOL, 2-acetamido-2-deoxy-beta-D-glucopyranose, 3-PYRIDINIUM-1-YLPROPANE-1-SULFONATE, ... Authors: Xiang, Y, Moremen, K.W. Deposit date: 2016-06-21 Release date: 2016-12-07 Last modified: 2020-07-29 Method: X-RAY DIFFRACTION (1.774 Å) Cite: Substrate recognition and catalysis by GH47 alpha-mannosidases involved in Asn-linked glycan maturation in the mammalian secretory pathway. Proc. Natl. Acad. Sci. U.S.A., 113, 2016
5L17	The crystal structure of neuraminidase in complex with zanamivir from A/Shanghai/2/2013 (H7N9) influenza virus Descriptor: 2-acetamido-2-deoxy-beta-D-glucopyranose, CALCIUM ION, Neuraminidase, ... Authors: Yang, H, Stevens, J. Deposit date: 2016-07-28 Release date: 2017-08-09 Last modified: 2023-10-04 Method: X-RAY DIFFRACTION (2.4 Å) Cite: Drug Susceptibility Evaluation of an Influenza A(H7N9) Virus by Analyzing Recombinant Neuraminidase Proteins. J. Infect. Dis., 216, 2017
5L0E	Crystal Structure of Autotaxin and Compound 1 Descriptor: 2-acetamido-2-deoxy-beta-D-glucopyranose, 6-(3-{2-[(2,3-dihydro-1H-inden-2-yl)amino]-7,8-dihydropyrido[4,3-d]pyrimidin-6(5H)-yl}propanoyl)-1,3-benzoxazol-2(3H)-one, CHLORIDE ION, ... Authors: Durbin, J.D. Deposit date: 2016-07-27 Release date: 2016-08-10 Last modified: 2020-07-29 Method: X-RAY DIFFRACTION (3.06 Å) Cite: Novel Autotaxin Inhibitors for the Treatment of Osteoarthritis Pain: Lead Optimization via Structure-Based Drug Design. Acs Med.Chem.Lett., 7, 2016
5L15	The crystal structure of neuraminidase in complex with oseltamivir from A/Shanghai/2/2013 (H7N9) influenza virus Descriptor: (3R,4R,5S)-4-(acetylamino)-5-amino-3-(pentan-3-yloxy)cyclohex-1-ene-1-carboxylic acid, 2-acetamido-2-deoxy-beta-D-glucopyranose, CALCIUM ION, ... Authors: Yang, H, Stevens, J. Deposit date: 2016-07-28 Release date: 2017-08-09 Last modified: 2023-10-04 Method: X-RAY DIFFRACTION (2.4 Å) Cite: Drug Susceptibility Evaluation of an Influenza A(H7N9) Virus by Analyzing Recombinant Neuraminidase Proteins. J. Infect. Dis., 216, 2017
5L14	The crystal structure of neuraminidase from A/Shanghai/2/2013 (H7N9) influenza virus Descriptor: 2-acetamido-2-deoxy-beta-D-glucopyranose, CALCIUM ION, Neuraminidase, ... Authors: Yang, H, Stevens, J. Deposit date: 2016-07-28 Release date: 2017-08-09 Last modified: 2023-10-04 Method: X-RAY DIFFRACTION (1.9 Å) Cite: Drug Susceptibility Evaluation of an Influenza A(H7N9) Virus by Analyzing Recombinant Neuraminidase Proteins. J. Infect. Dis., 216, 2017
5LGV	GlgE isoform 1 from Streptomyces coelicolor E423A mutant soaked in maltooctaose Descriptor: Alpha-1,4-glucan:maltose-1-phosphate maltosyltransferase 1, alpha-D-glucopyranose-(1-4)-alpha-D-glucopyranose-(1-4)-alpha-D-glucopyranose-(1-4)-alpha-D-glucopyranose-(1-4)-alpha-D-glucopyranose, alpha-D-glucopyranose-(1-4)-alpha-D-glucopyranose-(1-4)-alpha-D-glucopyranose-(1-4)-alpha-D-glucopyranose-(1-4)-alpha-D-glucopyranose-(1-4)-alpha-D-glucopyranose-(1-4)-alpha-D-glucopyranose-(1-4)-alpha-D-glucopyranose Authors: Syson, K, Stevenson, C.E.M, Mia, F, Barclay, J.E, Tang, M, Gorelik, A, Rashid, A.M, Lawson, D.M, Bornemann, S. Deposit date: 2016-07-08 Release date: 2016-08-17 Last modified: 2024-01-10 Method: X-RAY DIFFRACTION (2.5 Å) Cite: Ligand-bound structures and site-directed mutagenesis identify the acceptor and secondary binding sites of Streptomyces coelicolor maltosyltransferase GlgE. J.Biol.Chem., 291, 2016
5LGW	GlgE isoform 1 from Streptomyces coelicolor D394A mutant co-crystallised with maltodextrin Descriptor: 1,2-ETHANEDIOL, Alpha-1,4-glucan:maltose-1-phosphate maltosyltransferase 1, CITRIC ACID, ... Authors: Syson, K, Stevenson, C.E.M, Mia, F, Barclay, J.E, Tang, M, Gorelik, A, Rashid, A.M, Lawson, D.M, Bornemann, S. Deposit date: 2016-07-08 Release date: 2016-08-17 Last modified: 2024-01-10 Method: X-RAY DIFFRACTION (1.95 Å) Cite: Ligand-bound structures and site-directed mutagenesis identify the acceptor and secondary binding sites of Streptomyces coelicolor maltosyltransferase GlgE. J.Biol.Chem., 291, 2016
7OYB	Cryo-EM structure of the 6 hpf zebrafish embryo 80S ribosome Descriptor: 18S rRNA, 28S rRNA, 40S ribosomal protein S11, ... Authors: Leesch, F, Lorenzo-Orts, L, Grishkovskaya, I, Kandolf, S, Belacic, K, Meinhart, A, Haselbach, D, Pauli, A. Deposit date: 2021-06-24 Release date: 2022-07-13 Last modified: 2024-07-17 Method: ELECTRON MICROSCOPY (2.4 Å) Cite: A molecular network of conserved factors keeps ribosomes dormant in the egg. Nature, 613, 2023
7OYA	Cryo-EM structure of the 1 hpf zebrafish embryo 80S ribosome Descriptor: 18S rRNA, 28S rRNA, 40S ribosomal protein S11, ... Authors: Leesch, F, Lorenzo-Orts, L, Grishkovskaya, I, Kandolf, S, Belacic, K, Meinhart, A, Haselbach, D, Pauli, A. Deposit date: 2021-06-24 Release date: 2022-07-13 Last modified: 2023-02-08 Method: ELECTRON MICROSCOPY (3.2 Å) Cite: A molecular network of conserved factors keeps ribosomes dormant in the egg. Nature, 613, 2023
7OYC	Cryo-EM structure of the Xenopus egg 80S ribosome Descriptor: 18S rRNA, 28S rRNA, 40S ribosomal protein S10, ... Authors: Leesch, F, Lorenzo-Orts, L, Grishkovskaya, I, Kandolf, S, Belacic, K, Meinhart, A, Haselbach, D, Pauli, A. Deposit date: 2021-06-24 Release date: 2022-07-20 Last modified: 2023-02-08 Method: ELECTRON MICROSCOPY (2.4 Å) Cite: A molecular network of conserved factors keeps ribosomes dormant in the egg. Nature, 613, 2023

<27282930313233343536373839404142>