Loading
PDBj
MenuPDBj@FacebookPDBj@X(formerly Twitter)PDBj@BlueSkyPDBj@YouTubewwPDB FoundationwwPDBDonate
RCSB PDBPDBeBMRBAdv. SearchSearch help

2M6W

Solution NMR structure of the d(GGGGTTGGGGTTTTGGGGAAGGGG) quadruplex in sodium conditions

Summary for 2M6W
Entry DOI10.2210/pdb2m6w/pdb
NMR InformationBMRB: 19159
DescriptorDNA (5'-D(*GP*GP*GP*GP*TP*TP*GP*GP*GP*GP*TP*TP*TP*TP*GP*GP*GP*GP*AP*AP*GP*GP*GP*G)-3') (1 entity in total)
Functional Keywordsg-quadruplex, folding topology, dna
Total number of polymer chains1
Total formula weight7673.91
Authors
Karsisiotis, A.I.,Webba da Silva, M. (deposition date: 2013-04-19, release date: 2014-07-23, Last modification date: 2024-05-15)
Primary citationDvorkin, S.A.,Karsisiotis, A.I.,Webba da Silva, M.
Encoding canonical DNA quadruplex structure.
Sci Adv, 4:eaat3007-eaat3007, 2018
Cited by
PubMed Abstract: The main challenge in DNA quadruplex design is to encode a three-dimensional structure into the primary sequence, despite its multiple, repetitive guanine segments. We identify and detail structural elements describing all 14 feasible canonical quadruplex scaffolds and demonstrate their use in control of design. This work outlines a new roadmap for implementation of targeted design of quadruplexes for material, biotechnological, and therapeutic applications.
PubMed: 30182059
DOI: 10.1126/sciadv.aat3007
PDB entries with the same primary citation
Experimental method
SOLUTION NMR
Structure validation

250359

PDB entries from 2026-03-11

PDB statisticsPDBj update infoContact PDBjnumon