2M6W

Solution NMR structure of the d(GGGGTTGGGGTTTTGGGGAAGGGG) quadruplex in sodium conditions

Summary for 2M6W

• Entry DOI: 10.2210/pdb2m6w/pdb
• NMR Information: BMRB: 19159
• Descriptor: DNA (5'-D(*GP*GP*GP*GP*TP*TP*GP*GP*GP*GP*TP*TP*TP*TP*GP*GP*GP*GP*AP*AP*GP*GP*GP*G)-3') (1 entity in total)
• Functional Keywords: g-quadruplex, folding topology, dna
• Total number of polymer chains: 1
• Total formula weight: 7673.91

Authors

Karsisiotis, A.I.,Webba da Silva, M. (deposition date: 2013-04-19, release date: 2014-07-23, Last modification date: 2024-05-15)

Primary citation

Dvorkin, S.A.,Karsisiotis, A.I.,Webba da Silva, M.
Encoding canonical DNA quadruplex structure.
Sci Adv, 4:eaat3007-eaat3007, 2018

PubMed Abstract: The main challenge in DNA quadruplex design is to encode a three-dimensional structure into the primary sequence, despite its multiple, repetitive guanine segments. We identify and detail structural elements describing all 14 feasible canonical quadruplex scaffolds and demonstrate their use in control of design. This work outlines a new roadmap for implementation of targeted design of quadruplexes for material, biotechnological, and therapeutic applications.

PubMed: 30182059
DOI: 10.1126/sciadv.aat3007

Experimental method

SOLUTION NMR