2M6W
Solution NMR structure of the d(GGGGTTGGGGTTTTGGGGAAGGGG) quadruplex in sodium conditions
Summary for 2M6W
Entry DOI | 10.2210/pdb2m6w/pdb |
NMR Information | BMRB: 19159 |
Descriptor | DNA (5'-D(*GP*GP*GP*GP*TP*TP*GP*GP*GP*GP*TP*TP*TP*TP*GP*GP*GP*GP*AP*AP*GP*GP*GP*G)-3') (1 entity in total) |
Functional Keywords | g-quadruplex, folding topology, dna |
Total number of polymer chains | 1 |
Total formula weight | 7673.91 |
Authors | Karsisiotis, A.I.,Webba da Silva, M. (deposition date: 2013-04-19, release date: 2014-07-23, Last modification date: 2024-05-15) |
Primary citation | Dvorkin, S.A.,Karsisiotis, A.I.,Webba da Silva, M. Encoding canonical DNA quadruplex structure. Sci Adv, 4:eaat3007-eaat3007, 2018 Cited by PubMed Abstract: The main challenge in DNA quadruplex design is to encode a three-dimensional structure into the primary sequence, despite its multiple, repetitive guanine segments. We identify and detail structural elements describing all 14 feasible canonical quadruplex scaffolds and demonstrate their use in control of design. This work outlines a new roadmap for implementation of targeted design of quadruplexes for material, biotechnological, and therapeutic applications. PubMed: 30182059DOI: 10.1126/sciadv.aat3007 PDB entries with the same primary citation |
Experimental method | SOLUTION NMR |
Structure validation
Download full validation report
