2M6W

Solution NMR structure of the d(GGGGTTGGGGTTTTGGGGAAGGGG) quadruplex in sodium conditions

Entity

Entity ID	Chain ID	Description	Type	Chain length	Formula weight	Number of molecules	DB Name (Accession)	Biological source	Descriptive keywords
1	A (A)	DNA (5'-D(*GP*GP*GP*GP*TP*TP*GP*GP*GP*GP*TP*TP*TP*TP*GP*GP*GP*GP*AP*AP*GP*GP*GP*G)-3')	polymer	24	7673.9	1

Contents of the asymmetric unit

Polymers	Number of chains	1
	Total formula weight	7673.9
All*	Total formula weight	7673.9

*Water molecules are not included.