2M6W
Solution NMR structure of the d(GGGGTTGGGGTTTTGGGGAAGGGG) quadruplex in sodium conditions
Entity
Entity ID | Chain ID | Description | Type | Chain length | Formula weight | Number of molecules | DB Name (Accession) | Biological source | Descriptive keywords |
1 | A | DNA (5'-D(*GP*GP*GP*GP*TP*TP*GP*GP*GP*GP*TP*TP*TP*TP*GP*GP*GP*GP*AP*AP*GP*GP*GP*G)-3') | polymer | 24 | 7673.9 | 1 |
Sequence viewer
Contents of the asymmetric unit
Polymers | Number of chains | 1 |
Total formula weight | 7673.9 | |
All* | Total formula weight | 7673.9 |