2HUE
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 2hue by Molmil](/molmil-images/mine/2hue) | Structure of the H3-H4 chaperone Asf1 bound to histones H3 and H4 | Descriptor: | Anti-silencing protein 1, GLYCEROL, Histone H3, ... | Authors: | English, C.M, Churchill, M.E.A, Tyler, J.K. | Deposit date: | 2006-07-26 | Release date: | 2006-11-21 | Last modified: | 2024-02-14 | Method: | X-RAY DIFFRACTION (1.7 Å) | Cite: | Structural basis for the histone chaperone activity of asf1. Cell(Cambridge,Mass.), 127, 2006
|
|
3GV6
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 3gv6 by Molmil](/molmil-images/mine/3gv6) | Crystal Structure of human chromobox homolog 6 (CBX6) with H3K9 peptide | Descriptor: | Chromobox protein homolog 6, Histone H3K9me3 peptide | Authors: | Dong, A, Amaya, M.F, Li, Z, Loppnau, P, Kozieradzki, I, Edwards, A.M, Arrowsmith, C.H, Weigelt, J, Bountra, C, Bochkarev, A, Min, J, Ouyang, H, Structural Genomics Consortium (SGC) | Deposit date: | 2009-03-30 | Release date: | 2009-04-21 | Last modified: | 2023-09-06 | Method: | X-RAY DIFFRACTION (1.76 Å) | Cite: | Recognition and specificity determinants of the human cbx chromodomains. J.Biol.Chem., 286, 2011
|
|
1KX5
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 1kx5 by Molmil](/molmil-images/mine/1kx5) | X-Ray Structure of the Nucleosome Core Particle, NCP147, at 1.9 A Resolution | Descriptor: | CHLORIDE ION, DNA (5'(ATCAATATCCACCTGCAGATACTACCAAAAGTGTATTTGGAAACTGCTCCATCAAAAGGCATGTTCAGCTGGAATCCAGCTGAACATGCCTTTTGATGGAGCAGTTTCCAAATACACTTTTGGTAGTATCTGCAGGTGGATATTGAT)3'), DNA (5'(ATCAATATCCACCTGCAGATACTACCAAAAGTGTATTTGGAAACTGCTCCATCAAAAGGCATGTTCAGCTGGATTCCAGCTGAACATGCCTTTTGATGGAGCAGTTTCCAAATACACTTTTGGTAGTATCTGCAGGTGGATATTGAT)3'), ... | Authors: | Davey, C.A, Sargent, D.F, Luger, K, Maeder, A.W, Richmond, T.J. | Deposit date: | 2002-01-31 | Release date: | 2002-12-25 | Last modified: | 2023-08-16 | Method: | X-RAY DIFFRACTION (1.94 Å) | Cite: | Solvent Mediated Interactions in the Structure of the Nucleosome Core Particle at 1.9 A Resolution J.Mol.Biol., 319, 2002
|
|
1KX3
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 1kx3 by Molmil](/molmil-images/mine/1kx3) | X-Ray Structure of the Nucleosome Core Particle, NCP146, at 2.0 A Resolution | Descriptor: | DNA (5'(ATCAATATCCACCTGCAGATTCTACCAAAAGTGTATTTGGAAACTGCTCCATCAAAAGGCATGTTCAGCTGAATTCAGCTGAACATGCCTTTTGATGGAGCAGTTTCCAAATACACTTTTGGTAGAATCTGCAGGTGGATATTGAT)3'), MANGANESE (II) ION, histone H2A.1, ... | Authors: | Davey, C.A, Sargent, D.F, Luger, K, Maeder, A.W, Richmond, T.J. | Deposit date: | 2002-01-31 | Release date: | 2002-12-25 | Last modified: | 2023-08-16 | Method: | X-RAY DIFFRACTION (2 Å) | Cite: | Solvent Mediated Interactions in the Structure of the Nucleosome Core Particle at 1.9 A Resolution J.Mol.Biol., 319, 2002
|
|
4QEO
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 4qeo by Molmil](/molmil-images/mine/4qeo) | crystal structure of KRYPTONITE in complex with mCHH DNA, H3(1-15) peptide and SAH | Descriptor: | DNA 5'-ACTGATGAGTACCAT-3', DNA 5'-GGTACT(5CM)ATCAGTAT-3', Histone H3, ... | Authors: | Du, J, Li, S, Patel, D.J. | Deposit date: | 2014-05-17 | Release date: | 2014-07-30 | Last modified: | 2024-03-13 | Method: | X-RAY DIFFRACTION (2 Å) | Cite: | Mechanism of DNA Methylation-Directed Histone Methylation by KRYPTONITE. Mol.Cell, 55, 2014
|
|
1S32
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 1s32 by Molmil](/molmil-images/mine/1s32) | Molecular Recognition of the Nucleosomal 'Supergroove' | Descriptor: | 2-(2-CARBAMOYLMETHOXY-ETHOXY)-ACETAMIDE, 3-AMINO-(DIMETHYLPROPYLAMINE), 4-AMINO-(1-METHYLIMIDAZOLE)-2-CARBOXYLIC ACID, ... | Authors: | Edayathumangalam, R.S, Weyermann, P, Gottesfeld, J.M, Dervan, P.B, Luger, K. | Deposit date: | 2004-01-12 | Release date: | 2004-05-11 | Last modified: | 2023-11-15 | Method: | X-RAY DIFFRACTION (2.05 Å) | Cite: | Molecular Recognition of the Nucleosomal 'Supergroove' Proc.Natl.Acad.Sci.USA, 101, 2004
|
|
3UTA
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 3uta by Molmil](/molmil-images/mine/3uta) | Crystal Structure of Nucleosome Core Particle Assembled with an Alpha-Satellite Sequence Containing Two TTAAA elements (NCP-TA2) | Descriptor: | 145-mer DNA, CHLORIDE ION, Histone H2A, ... | Authors: | Chua, E.Y.D, Vasudevan, D, Davey, G.E, Wu, B, Davey, C.A. | Deposit date: | 2011-11-25 | Release date: | 2012-04-11 | Last modified: | 2024-03-20 | Method: | X-RAY DIFFRACTION (2.07 Å) | Cite: | The mechanics behind DNA sequence-dependent properties of the nucleosome Nucleic Acids Res., 40, 2012
|
|
6WZ5
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 6wz5 by Molmil](/molmil-images/mine/6wz5) | |
3UTB
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 3utb by Molmil](/molmil-images/mine/3utb) | Crystal Structure of Nucleosome Core Particle Assembled with the 146b Alpha-Satellite Sequence (NCP146b) | Descriptor: | 146-mer DNA, Histone H2A, Histone H2B 1.1, ... | Authors: | Chua, E.Y.D, Vasudevan, D, Davey, G.E, Wu, B, Davey, C.A. | Deposit date: | 2011-11-25 | Release date: | 2012-04-11 | Last modified: | 2024-03-20 | Method: | X-RAY DIFFRACTION (2.2 Å) | Cite: | The mechanics behind DNA sequence-dependent properties of the nucleosome Nucleic Acids Res., 40, 2012
|
|
3C1B
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 3c1b by Molmil](/molmil-images/mine/3c1b) | The effect of H3 K79 dimethylation and H4 K20 trimethylation on nucleosome and chromatin structure | Descriptor: | Histone 2, H2bf, Histone H2A type 1, ... | Authors: | Lu, X, Simon, M, Chodaparambil, J, Hansen, J, Shokat, K, Luger, K. | Deposit date: | 2008-01-22 | Release date: | 2008-10-07 | Last modified: | 2023-11-15 | Method: | X-RAY DIFFRACTION (2.2 Å) | Cite: | The effect of H3K79 dimethylation and H4K20 trimethylation on nucleosome and chromatin structure. Nat.Struct.Mol.Biol., 15, 2008
|
|
3UT9
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 3ut9 by Molmil](/molmil-images/mine/3ut9) | Crystal Structure of Nucleosome Core Particle Assembled with a Palindromic Widom '601' Derivative (NCP-601L) | Descriptor: | 145-mer DNA, CHLORIDE ION, Histone H2A, ... | Authors: | Chua, E.Y.D, Vasudevan, D, Davey, G.E, Wu, B, Davey, C.A. | Deposit date: | 2011-11-25 | Release date: | 2012-04-11 | Last modified: | 2024-03-20 | Method: | X-RAY DIFFRACTION (2.2 Å) | Cite: | The mechanics behind DNA sequence-dependent properties of the nucleosome Nucleic Acids Res., 40, 2012
|
|
3MGR
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 3mgr by Molmil](/molmil-images/mine/3mgr) | Binding of Rubidium ions to the Nucleosome Core Particle | Descriptor: | CHLORIDE ION, DNA (147-MER), Histone H2A, ... | Authors: | Mohideen, K, Muhammad, R, Davey, C.A. | Deposit date: | 2010-04-07 | Release date: | 2010-06-16 | Last modified: | 2023-11-01 | Method: | X-RAY DIFFRACTION (2.3 Å) | Cite: | Perturbations in nucleosome structure from heavy metal association. Nucleic Acids Res., 38, 2010
|
|
8G88
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 8g88 by Molmil](/molmil-images/mine/8g88) | Human Oct4 bound to nucleosome with human nMatn1 sequence | Descriptor: | Histone H2A, Histone H2B, Histone H3, ... | Authors: | Sinha, K.K, Bilokapic, S, Du, Y, Malik, D, Halic, M. | Deposit date: | 2023-02-17 | Release date: | 2023-03-22 | Last modified: | 2024-06-19 | Method: | ELECTRON MICROSCOPY (2.3 Å) | Cite: | Histone modifications regulate pioneer transcription factor cooperativity. Nature, 619, 2023
|
|
8G86
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 8g86 by Molmil](/molmil-images/mine/8g86) | Human Oct4 bound to nucleosome with human nMatn1 sequence (focused refinement of nucleosome) | Descriptor: | Histone H2A, Histone H2B, Histone H3, ... | Authors: | Sinha, K.K, Bilokapic, S, Du, Y, Malik, D, Halic, M. | Deposit date: | 2023-02-17 | Release date: | 2023-03-22 | Last modified: | 2024-06-19 | Method: | ELECTRON MICROSCOPY (2.3 Å) | Cite: | Histone modifications regulate pioneer transcription factor cooperativity. Nature, 619, 2023
|
|
7TN2
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 7tn2 by Molmil](/molmil-images/mine/7tn2) | Composite model of a Chd1-nucleosome complex in the nucleotide-free state derived from 2.3A and 2.7A Cryo-EM maps | Descriptor: | Chromo domain-containing protein 1, DNA Lagging Strand, DNA Tracking Strand, ... | Authors: | Nodelman, I.M, Bowman, G.D, Armache, J.-P. | Deposit date: | 2022-01-20 | Release date: | 2022-03-02 | Last modified: | 2024-02-21 | Method: | ELECTRON MICROSCOPY (2.3 Å) | Cite: | Nucleosome recognition and DNA distortion by the Chd1 remodeler in a nucleotide-free state. Nat.Struct.Mol.Biol., 29, 2022
|
|
1P3I
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 1p3i by Molmil](/molmil-images/mine/1p3i) | Crystallographic Studies of Nucleosome Core Particles containing Histone 'Sin' Mutants | Descriptor: | Histone H2A, Histone H2B, Histone H3, ... | Authors: | Muthurajan, U.M, Bao, Y, Forsberg, L.J, Edayathumangalam, R.S, Dyer, P.N, White, C.L, Luger, K. | Deposit date: | 2003-04-17 | Release date: | 2004-02-24 | Last modified: | 2023-08-16 | Method: | X-RAY DIFFRACTION (2.3 Å) | Cite: | Crystal structures of histone Sin mutant nucleosomes reveal altered protein-DNA interactions EMBO J., 23, 2004
|
|
5OMX
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 5omx by Molmil](/molmil-images/mine/5omx) | |
4EO5
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 4eo5 by Molmil](/molmil-images/mine/4eo5) | Yeast Asf1 bound to H3/H4G94P mutant | Descriptor: | ACETATE ION, GLYCEROL, Histone H3.2, ... | Authors: | Scorgie, J.K, Churchill, M.E. | Deposit date: | 2012-04-13 | Release date: | 2012-06-13 | Last modified: | 2023-09-13 | Method: | X-RAY DIFFRACTION (2.35 Å) | Cite: | The conformational flexibility of the C-terminus of histone H4 promotes histone octamer and nucleosome stability and yeast viability. Epigenetics Chromatin, 5, 2012
|
|
4J8U
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 4j8u by Molmil](/molmil-images/mine/4j8u) | |
1P3L
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 1p3l by Molmil](/molmil-images/mine/1p3l) | Crystallographic Studies of Nucleosome Core Particles containing Histone 'Sin' Mutants | Descriptor: | Histone H2A, Histone H2B, Histone H3, ... | Authors: | Muthurajan, U.M, Bao, Y, Forsberg, L.J, Edayathumangalam, R.S, Dyer, P.N, White, C.L, Luger, K. | Deposit date: | 2003-04-17 | Release date: | 2004-02-24 | Last modified: | 2023-08-16 | Method: | X-RAY DIFFRACTION (2.4 Å) | Cite: | Crystal structures of histone Sin mutant nucleosomes reveal altered protein-DNA interactions EMBO J., 23, 2004
|
|
4XZQ
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 4xzq by Molmil](/molmil-images/mine/4xzq) | Nucleosome disassembly by RSC and SWI/SNF is enhanced by H3 acetylation near the nucleosome dyad axis | Descriptor: | DNA (147-MER), Histone H2A, Histone H2B 1.1, ... | Authors: | Dechassa, M.L, Luger, K, Chatterjee, N, North, J.A, Manohar, M, Prasad, R, Ottessen, J.J, Poirier, M.G, Bartholomew, B. | Deposit date: | 2015-02-04 | Release date: | 2015-10-14 | Last modified: | 2023-11-15 | Method: | X-RAY DIFFRACTION (2.4 Å) | Cite: | Histone Acetylation near the Nucleosome Dyad Axis Enhances Nucleosome Disassembly by RSC and SWI/SNF. Mol.Cell.Biol., 35, 2015
|
|
4J8W
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 4j8w by Molmil](/molmil-images/mine/4j8w) | |
3MGP
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 3mgp by Molmil](/molmil-images/mine/3mgp) | Binding of Cobalt ions to the Nucleosome Core Particle | Descriptor: | CHLORIDE ION, COBALT (II) ION, DNA (147-MER), ... | Authors: | Mohideen, K, Muhammad, R, Davey, C.A. | Deposit date: | 2010-04-07 | Release date: | 2010-06-16 | Last modified: | 2023-11-01 | Method: | X-RAY DIFFRACTION (2.44 Å) | Cite: | Perturbations in nucleosome structure from heavy metal association. Nucleic Acids Res., 38, 2010
|
|
4WU8
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 4wu8 by Molmil](/molmil-images/mine/4wu8) | Structure of trPtNAP-NCP145 | Descriptor: | DNA (145-MER), Histone H2A type 1, Histone H2B 1.1, ... | Authors: | Chua, E.Y.D, Davey, C.A. | Deposit date: | 2014-10-31 | Release date: | 2015-09-02 | Last modified: | 2024-03-20 | Method: | X-RAY DIFFRACTION (2.45 Å) | Cite: | Stereochemical control of nucleosome targeting by platinum-intercalator antitumor agents. Nucleic Acids Res., 43, 2015
|
|
3LZ0
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 3lz0 by Molmil](/molmil-images/mine/3lz0) | Crystal Structure of Nucleosome Core Particle Composed of the Widom 601 DNA Sequence (orientation 1) | Descriptor: | CHLORIDE ION, DNA (145-MER), Histone H2A, ... | Authors: | Vasudevan, D, Chua, E.Y.D, Davey, C.A. | Deposit date: | 2010-03-01 | Release date: | 2010-09-15 | Last modified: | 2023-11-01 | Method: | X-RAY DIFFRACTION (2.5 Å) | Cite: | Crystal structures of nucleosome core particles containing the '601' strong positioning sequence J.Mol.Biol., 403, 2010
|
|