8I87
| Cryo-EM structure of TIR-APAZ/Ago-gRNA-DNA complex | Descriptor: | DNA (5'-D(P*TP*AP*TP*AP*CP*AP*AP*CP*CP*TP*AP*CP*TP*AP*CP*CP*TP*CP*A)-3'), MAGNESIUM ION, Piwi domain-containing protein, ... | Authors: | Zhang, H, Deng, Z.Q, Yu, G.M, Li, X.Z, Wang, X.S. | Deposit date: | 2023-02-03 | Release date: | 2023-07-19 | Last modified: | 2023-09-13 | Method: | ELECTRON MICROSCOPY (3.1 Å) | Cite: | Structural insights into mechanisms of Argonaute protein-associated NADase activation in bacterial immunity. Cell Res., 33, 2023
|
|
1R7Z
| NMR STRUCTURE OF THE R(GGAGGACAUUCCUCACGGGUGACCGUGGUCCUCC), DOMAIN IV STEM-LOOP B OF ENTEROVIRAL IRES WITH AUUCCU BULGE | Descriptor: | 34-MER | Authors: | Du, Z, Ulyanov, N.B, Yu, J, James, T.L. | Deposit date: | 2003-10-22 | Release date: | 2004-05-25 | Last modified: | 2024-05-22 | Method: | SOLUTION NMR | Cite: | NMR Structures of Loop B RNAs from the Stem-Loop IV Domain of the Enterovirus Internal Ribosome Entry Site: A Single C to U Substitution Drastically Changes the Shape and Flexibility of RNA(,). Biochemistry, 43, 2004
|
|
6BW3
| Crystal structure of RBBP4 in complex with PRDM3 N-terminal peptide | Descriptor: | Histone-binding protein RBBP4, MDS1 and EVI1 complex locus protein MDS1, UNKNOWN ATOM OR ION | Authors: | Ivanochko, D, Halabelian, L, Hutchinson, A, Seitova, A, Bountra, C, Edwards, A.M, Arrowsmith, C.H, Structural Genomics Consortium (SGC) | Deposit date: | 2017-12-14 | Release date: | 2017-12-27 | Last modified: | 2023-10-04 | Method: | X-RAY DIFFRACTION (2.2 Å) | Cite: | Direct interaction between the PRDM3 and PRDM16 tumor suppressors and the NuRD chromatin remodeling complex. Nucleic Acids Res., 47, 2019
|
|
6BW4
| Crystal structure of RBBP4 in complex with PRDM16 N-terminal peptide | Descriptor: | Histone-binding protein RBBP4, PR domain zinc finger protein 16, UNKNOWN ATOM OR ION | Authors: | Ivanochko, D, Halabelian, L, Hutchinson, A, Seitova, A, Bountra, C, Edwards, A.M, Arrowsmith, C.H, Structural Genomics Consortium (SGC) | Deposit date: | 2017-12-14 | Release date: | 2017-12-27 | Last modified: | 2023-10-04 | Method: | X-RAY DIFFRACTION (2 Å) | Cite: | Direct interaction between the PRDM3 and PRDM16 tumor suppressors and the NuRD chromatin remodeling complex. Nucleic Acids Res., 47, 2019
|
|
6YI3
| |
6GBS
| Crystal Structure of the C. themophilum Scavenger Decapping Enzyme DcpS apo form | Descriptor: | 1,2-ETHANEDIOL, DI(HYDROXYETHYL)ETHER, Putative mRNA decapping protein | Authors: | Fuchs, A.-L, Neu, A, Sprangers, R. | Deposit date: | 2018-04-16 | Release date: | 2019-04-24 | Last modified: | 2024-01-17 | Method: | X-RAY DIFFRACTION (1.946 Å) | Cite: | Molecular basis of the selective processing of short mRNA substrates by the DcpS mRNA decapping enzyme. Proc.Natl.Acad.Sci.USA, 117, 2020
|
|
1R7W
| NMR STRUCTURE OF THE R(GGAGGACAUCCCUCACGGGUGACCGUGGUCCUCC), DOMAIN IV STEM-LOOP B OF ENTEROVIRAL IRES WITH AUCCCU BULGE | Descriptor: | 34-MER | Authors: | Du, Z, Ulyanov, N.B, Yu, J, James, T.L. | Deposit date: | 2003-10-22 | Release date: | 2004-05-25 | Last modified: | 2024-05-22 | Method: | SOLUTION NMR | Cite: | NMR Structures of Loop B RNAs from the Stem-Loop IV Domain of the Enterovirus Internal Ribosome Entry Site: A Single C to U Substitution Drastically Changes the Shape and Flexibility of RNA(,). Biochemistry, 43, 2004
|
|
8DRH
| HIGH RESOLUTION NMR STRUCTURE OF THE D(GCGTCAGG)R(CCUGACGC) HYBRID, MINIMIZED AVERAGE STRUCTURE | Descriptor: | DNA (5'-D(*GP*CP*GP*TP*CP*AP*GP*G)-3'), RNA (5'-R(*CP*CP*UP*GP*AP*CP*GP*C)-3') | Authors: | Bachelin, M, Hessler, G, Kurz, G, Hacia, J.G, Dervan, P.B, Kessler, H. | Deposit date: | 1997-10-13 | Release date: | 1998-05-27 | Last modified: | 2024-05-22 | Method: | SOLUTION NMR | Cite: | Structure of a Stereoregular Phosphorothioate DNA/RNA Duplex Nat.Struct.Biol., 5, 1998
|
|
7KFF
| Crystal structure of TrmD tRNA (guanine-N1)-methyltransferase from Corynebacterium diphtheriae in complex with SAH | Descriptor: | ACETATE ION, S-ADENOSYL-L-HOMOCYSTEINE, tRNA (guanine-N(1)-)-methyltransferase | Authors: | Michalska, K, Tanase, L, Maltseva, N, Kim, Y, Endres, M, Joachimiak, A, Center for Structural Genomics of Infectious Diseases (CSGID) | Deposit date: | 2020-10-13 | Release date: | 2020-10-28 | Method: | X-RAY DIFFRACTION (1.35 Å) | Cite: | Crystal structure of TrmD tRNA (guanine-N1)-methyltransferase from Corynebacterium diphtheriae in complex with SAH To Be Published
|
|
2I38
| Solution structure of the RRM of SRp20 | Descriptor: | Fusion protein consists of immunoglobulin G-Binding Protein G and Splicing factor, arginine/serine-rich 3 | Authors: | Hargous, Y.F, Allain, F.H.T. | Deposit date: | 2006-08-17 | Release date: | 2006-12-12 | Last modified: | 2024-05-29 | Method: | SOLUTION NMR | Cite: | Molecular basis of RNA recognition and TAP binding by the SR proteins SRp20 and 9G8. Embo J., 25, 2006
|
|
2CW0
| Crystal structure of Thermus thermophilus RNA polymerase holoenzyme at 3.3 angstroms resolution | Descriptor: | DNA-directed RNA polymerase alpha chain, DNA-directed RNA polymerase beta chain, DNA-directed RNA polymerase beta' chain, ... | Authors: | Tuske, S, Sarafianos, S.G, Wang, X, Hudson, B, Sineva, E, Mukhopadhyay, J, Birktoft, J.J, Leroy, O, Ismail, S, Clark Jr, A.D, Dharia, C, Napoli, A, Laptenko, O, Lee, J, Borukhov, S, Ebright, R.H, Arnold, E. | Deposit date: | 2005-06-15 | Release date: | 2005-09-20 | Last modified: | 2023-10-25 | Method: | X-RAY DIFFRACTION (3.3 Å) | Cite: | Inhibition of bacterial RNA polymerase by streptolydigin: stabilization of a straight-bridge-helix active-center conformation Cell(Cambridge,Mass.), 122, 2005
|
|
7WV5
| ectoTLR3-poly(I:C) | Descriptor: | 2-acetamido-2-deoxy-beta-D-glucopyranose, 2-acetamido-2-deoxy-beta-D-glucopyranose-(1-4)-2-acetamido-2-deoxy-beta-D-glucopyranose, RNA (46-MER), ... | Authors: | Lim, C.S, Jang, Y.H, Lee, G.Y, Han, G.M, Lee, J.O. | Deposit date: | 2022-02-09 | Release date: | 2022-11-16 | Last modified: | 2022-12-07 | Method: | ELECTRON MICROSCOPY (3.1 Å) | Cite: | TLR3 forms a highly organized cluster when bound to a poly(I:C) RNA ligand. Nat Commun, 13, 2022
|
|
4F02
| |
3PEU
| S. cerevisiae Dbp5 L327V C-terminal domain bound to Gle1 H337R and IP6 | Descriptor: | ATP-dependent RNA helicase DBP5, GLYCEROL, INOSITOL HEXAKISPHOSPHATE, ... | Authors: | Montpetit, B, Thomsen, N.D, Helmke, K.J, Seeliger, M.A, Berger, J.M, Weis, K. | Deposit date: | 2010-10-27 | Release date: | 2011-03-23 | Last modified: | 2020-10-14 | Method: | X-RAY DIFFRACTION (2.6 Å) | Cite: | A conserved mechanism of DEAD-box ATPase activation by nucleoporins and InsP(6) in mRNA export. Nature, 472, 2011
|
|
3PEV
| S. cerevisiae Dbp5 L327V C-terminal domain bound to Gle1 and IP6 | Descriptor: | ATP-dependent RNA helicase DBP5, GLYCEROL, INOSITOL HEXAKISPHOSPHATE, ... | Authors: | Montpetit, B, Thomsen, N.D, Helmke, K.J, Seeliger, M.A, Berger, J.M, Weis, K. | Deposit date: | 2010-10-27 | Release date: | 2011-03-23 | Last modified: | 2020-10-14 | Method: | X-RAY DIFFRACTION (2.499 Å) | Cite: | A conserved mechanism of DEAD-box ATPase activation by nucleoporins and InsP(6) in mRNA export. Nature, 472, 2011
|
|
1HYS
| CRYSTAL STRUCTURE OF HIV-1 REVERSE TRANSCRIPTASE IN COMPLEX WITH A POLYPURINE TRACT RNA:DNA | Descriptor: | 5'-D(*CP*TP*TP*TP*TP*CP*TP*TP*TP*TP*AP*AP*AP*AP*AP*GP*TP*GP*GP*CP*TP*G)-3', 5'-R(*UP*CP*AP*GP*CP*CP*AP*CP*UP*UP*UP*UP*UP*AP*AP*AP*AP*GP*AP*AP*AP*AP*G)-3', FAB-28 MONOCLONAL ANTIBODY FRAGMENT HEAVY CHAIN, ... | Authors: | Sarafianos, S.G, Das, K, Tantillo, C, Clark Jr, A.D, Ding, J, Whitcomb, J, Boyer, P.L, Hughes, S.H, Arnold, E. | Deposit date: | 2001-01-22 | Release date: | 2001-03-26 | Last modified: | 2023-08-09 | Method: | X-RAY DIFFRACTION (3 Å) | Cite: | Crystal structure of HIV-1 reverse transcriptase in complex with a polypurine tract RNA:DNA. EMBO J., 20, 2001
|
|
1WPT
| Crystal Structure of HutP, an RNA binding anti-termination protein | Descriptor: | Hut operon positive regulatory protein | Authors: | Kumarevel, T, Mizuno, H, Kumar, P.K.R. | Deposit date: | 2004-09-13 | Release date: | 2005-08-30 | Last modified: | 2023-10-25 | Method: | X-RAY DIFFRACTION (2.7 Å) | Cite: | Characterization of the metal ion binding site in the anti-terminator protein, HutP, of Bacillus subtilis Nucleic Acids Res., 33, 2005
|
|
6WW6
| Crystal structure of EutV bound to RNA | Descriptor: | BERYLLIUM TRIFLUORIDE ION, Response regulator, eutP P2 | Authors: | Ataide, S.F, Walshe, J.L. | Deposit date: | 2020-05-07 | Release date: | 2021-11-24 | Last modified: | 2023-10-18 | Method: | X-RAY DIFFRACTION (3.8 Å) | Cite: | Structural characterization of the ANTAR antiterminator domain bound to RNA. Nucleic Acids Res., 50, 2022
|
|
1OKF
| NMR structure of an alpha-L-LNA:RNA hybrid | Descriptor: | 5'-D(*CP*ATLP*GP*AP*ATLP*AP*ATLP*GP*CP)-3', 5'-R(*GP*CP*AP*UP*AP*UP*CP*AP*GP)-3' | Authors: | Nielsen, J.T, Stein, P.C, Petersen, M. | Deposit date: | 2003-07-23 | Release date: | 2003-10-09 | Last modified: | 2024-05-15 | Method: | SOLUTION NMR | Cite: | NMR Structure of an Alpha-L-Lna:RNA Hybrid: Structural Implications for Rnase H Recognition Nucleic Acids Res., 31, 2003
|
|
2BS1
| MS2 (N87AE89K mutant) - Qbeta RNA hairpin complex | Descriptor: | 5'-R(*AP*CP*AP*UP*GP*AP*GP*GP*AP*UP *UP*AP*CP*CP*CP*AP*UP*GP*U)-3', MS2 COAT PROTEIN | Authors: | Horn, W.T, Tars, K, Grahn, E, Helgstrand, C, Baron, A.J, Lago, H, Adams, C.J, Peabody, D.S, Phillips, S.E.V, Stonehouse, N.J, Liljas, L, Stockley, P.G. | Deposit date: | 2005-05-13 | Release date: | 2006-03-22 | Last modified: | 2023-12-13 | Method: | X-RAY DIFFRACTION (2.8 Å) | Cite: | Structural Basis of RNA Binding Discrimination between Bacteriophages Qbeta and MS2. Structure, 14, 2006
|
|
2BNY
| MS2 (N87A mutant) - RNA hairpin complex | Descriptor: | 5'-R(*AP*CP*AP*UP*GP*AP*GP*GP*AP*UP *UP*AP*CP*CP*CP*AP*UP*GP*U)-3', MS2 COAT PROTEIN | Authors: | Horn, W.T, Tars, K, Grahn, E, Helgstrand, C, Baron, A.J, Lago, H, Adams, C.J, Peabody, D.S, Phillips, S.E.V, Stonehouse, N.J, Liljas, L, Stockley, P.G. | Deposit date: | 2005-04-06 | Release date: | 2006-03-22 | Last modified: | 2023-12-13 | Method: | X-RAY DIFFRACTION (3 Å) | Cite: | Structural Basis of RNA Binding Discrimination between Bacteriophages Qbeta and MS2. Structure, 14, 2006
|
|
4R09
| Crystal structure of human TLR8 in complex with ORN06S | Descriptor: | 1-[(2R,3aR,4R,6R,6aR)-2-hydroxy-6-(hydroxymethyl)-2-sulfidotetrahydrofuro[3,4-d][1,3,2]dioxaphosphol-4-yl]pyrimidine-2,4(1H,3H)-dione, 2-acetamido-2-deoxy-beta-D-glucopyranose, 2-acetamido-2-deoxy-beta-D-glucopyranose-(1-4)-2-acetamido-2-deoxy-beta-D-glucopyranose, ... | Authors: | Tanji, H, Ohto, U, Shimizu, T. | Deposit date: | 2014-07-30 | Release date: | 2015-01-14 | Last modified: | 2020-07-29 | Method: | X-RAY DIFFRACTION (2.62 Å) | Cite: | Toll-like receptor 8 senses degradation products of single-stranded RNA. Nat.Struct.Mol.Biol., 22, 2015
|
|
2BQ5
| MS2 (N87AE89K mutant) - RNA hairpin complex | Descriptor: | 5'-R(*AP*CP*AP*UP*GP*AP*GP*GP*AP*UP *UP*AP*CP*CP*CP*AP*UP*GP*U)-3', COAT PROTEIN | Authors: | Horn, W.T, Tars, K, Grahn, E, Helgstrand, C, Baron, A.J, Lago, H, Adams, C.J, Peabody, D.S, Phillips, S.E.V, Stonehouse, N.J, Liljas, L, Stockley, P.G. | Deposit date: | 2005-04-27 | Release date: | 2006-03-22 | Last modified: | 2023-12-13 | Method: | X-RAY DIFFRACTION (2.91 Å) | Cite: | Structural Basis of RNA Binding Discrimination between Bacteriophages Qbeta and MS2. Structure, 14, 2006
|
|
2OB7
| Structure of tmRNA-(SmpB)2 complex as inferred from cryo-EM | Descriptor: | 16S ribosomal RNA, SsrA-binding protein, transfer-messenger RNA | Authors: | Frank, J, Felden, B, Gillet, R, Li, W. | Deposit date: | 2006-12-18 | Release date: | 2007-01-23 | Last modified: | 2023-12-27 | Method: | ELECTRON MICROSCOPY (13.6 Å) | Cite: | Scaffolding as an organizing principle in trans-translation. The roles of small protein B and ribosomal protein S1. J.Biol.Chem., 282, 2007
|
|
6YMC
| 26-mer stem-loop RNA | Descriptor: | BARIUM ION, RNA (26-MER) | Authors: | Janowski, R, Niessing, D. | Deposit date: | 2020-04-08 | Release date: | 2022-04-20 | Last modified: | 2024-06-19 | Method: | X-RAY DIFFRACTION (2 Å) | Cite: | Multiple intrinsically disordered RNA-binding motifs cooperate as RNA-folding catalyst and mediate phase transition To Be Published
|
|