4WK8
 
 | | FOXP3 forms a domain-swapped dimer to bridge DNA | | Descriptor: | DNA (5'-D(*AP*AP*CP*TP*AP*TP*GP*AP*AP*AP*CP*AP*AP*AP*TP*TP*TP*TP*CP*CP*T)-3'), DNA (5'-D(*TP*TP*AP*GP*GP*AP*AP*AP*AP*TP*TP*TP*GP*TP*TP*TP*CP*AP*TP*AP*G)-3'), Forkhead box protein P3 | | Authors: | Chen, Y, Chen, L. | | Deposit date: | 2014-10-01 | | Release date: | 2015-01-21 | | Last modified: | 2023-12-27 | | Method: | X-RAY DIFFRACTION (3.4006 Å) | | Cite: | DNA binding by FOXP3 domain-swapped dimer suggests mechanisms of long-range chromosomal interactions.
Nucleic Acids Res., 43, 2015
|
|
5ZLD
 | |
5YUR
 | | DNA polymerase IV - DNA ternary complex 1 | | Descriptor: | DNA polymerase IV, DTN, SODIUM ION, ... | | Authors: | Kottur, J, Nair, D.T. | | Deposit date: | 2017-11-23 | | Release date: | 2018-08-29 | | Last modified: | 2023-11-22 | | Method: | X-RAY DIFFRACTION (2.035 Å) | | Cite: | Pyrophosphate hydrolysis is an intrinsic and critical step of the DNA synthesis reaction
Nucleic Acids Res., 46, 2018
|
|
5YUT
 | | DNA polymerase IV - DNA ternary complex 3 | | Descriptor: | DNA polymerase IV, DTN, MAGNESIUM ION, ... | | Authors: | Kottur, J, Nair, D.T. | | Deposit date: | 2017-11-23 | | Release date: | 2018-09-05 | | Last modified: | 2023-11-22 | | Method: | X-RAY DIFFRACTION (2.15 Å) | | Cite: | Pyrophosphate hydrolysis is an intrinsic and critical step of the DNA synthesis reaction
Nucleic Acids Res., 46, 2018
|
|
5YUU
 | | DNA polymerase IV - DNA ternary complex 4 | | Descriptor: | DNA polymerase IV, DTN1, DTN2, ... | | Authors: | Kottur, J, Nair, D.T. | | Deposit date: | 2017-11-23 | | Release date: | 2019-01-02 | | Last modified: | 2023-11-22 | | Method: | X-RAY DIFFRACTION (1.892 Å) | | Cite: | Pyrophosphate hydrolysis is an intrinsic and critical step of the DNA synthesis reaction
Nucleic Acids Res., 46, 2018
|
|
5YUS
 | | DNA polymerase IV - DNA ternary complex 2 | | Descriptor: | DNA polymerase IV, DTN, MAGNESIUM ION, ... | | Authors: | Kottur, J, Nair, D.T. | | Deposit date: | 2017-11-23 | | Release date: | 2018-11-07 | | Last modified: | 2024-03-27 | | Method: | X-RAY DIFFRACTION (1.94 Å) | | Cite: | Pyrophosphate hydrolysis is an intrinsic and critical step of the DNA synthesis reaction
Nucleic Acids Res., 46, 2018
|
|
5YUV
 | | DNA polymerase IV - DNA ternary complex 5 | | Descriptor: | DNA polymerase IV, DTN1, DTN2, ... | | Authors: | Kottur, J, Nair, D.T. | | Deposit date: | 2017-11-23 | | Release date: | 2018-10-03 | | Last modified: | 2023-11-22 | | Method: | X-RAY DIFFRACTION (2.06 Å) | | Cite: | Pyrophosphate hydrolysis is an intrinsic and critical step of the DNA synthesis reaction
Nucleic Acids Res., 46, 2018
|
|
5YUW
 | | DNA polymerase IV - DNA ternary complex 6 | | Descriptor: | DNA polymerase IV, DTN1, DTN2C, ... | | Authors: | Kottur, J, Nair, D.T. | | Deposit date: | 2017-11-23 | | Release date: | 2018-11-07 | | Last modified: | 2023-11-22 | | Method: | X-RAY DIFFRACTION (2.124 Å) | | Cite: | Pyrophosphate hydrolysis is an intrinsic and critical step of the DNA synthesis reaction
Nucleic Acids Res., 46, 2018
|
|
5YV2
 | | DNA polymerase IV - DNA ternary complex 14 | | Descriptor: | DNA polymerase IV, DTN1, DTN2, ... | | Authors: | Kottur, J, Nair, D.T. | | Deposit date: | 2017-11-23 | | Release date: | 2018-09-05 | | Last modified: | 2023-11-22 | | Method: | X-RAY DIFFRACTION (1.9 Å) | | Cite: | Pyrophosphate hydrolysis is an intrinsic and critical step of the DNA synthesis reaction
Nucleic Acids Res., 46, 2018
|
|
6ASD
 | | Zinc finger region of human TET1 in complex with CpG DNA | | Descriptor: | DNA (5'-D(*GP*CP*CP*AP*CP*CP*GP*GP*TP*GP*GP*C)-3'), Methylcytosine dioxygenase TET1, UNKNOWN ATOM OR ION, ... | | Authors: | Liu, K, Xu, C, Tempel, W, Walker, J.R, Arrowsmith, C.H, Bountra, C, Edwards, A.M, Min, J, Structural Genomics Consortium (SGC) | | Deposit date: | 2017-08-24 | | Release date: | 2017-10-18 | | Last modified: | 2023-10-04 | | Method: | X-RAY DIFFRACTION (1.85 Å) | | Cite: | DNA Sequence Recognition of Human CXXC Domains and Their Structural Determinants.
Structure, 26, 2018
|
|
6ASB
 | | CXXC and PHD-type zinc finger regions of FBXL19 in complex with DNA | | Descriptor: | DNA (5'-D(*GP*CP*CP*AP*AP*CP*GP*TP*TP*GP*GP*C)-3'), F-box/LRR-repeat protein 19, ZINC ION | | Authors: | Liu, K, Tempel, W, Walker, J.R, Arrowsmith, C.H, Bountra, C, Edwards, A.M, Min, J, Structural Genomics Consortium (SGC) | | Deposit date: | 2017-08-24 | | Release date: | 2017-10-18 | | Last modified: | 2023-10-04 | | Method: | X-RAY DIFFRACTION (2.85 Å) | | Cite: | DNA Sequence Recognition of Human CXXC Domains and Their Structural Determinants.
Structure, 26, 2018
|
|
5U9H
 | | DNA polymerase beta product complex with inserted Sp-isomer of dCTP-alpha-S | | Descriptor: | DNA (5'-D(*CP*CP*GP*AP*CP*GP*GP*CP*GP*CP*AP*TP*CP*AP*GP*C)-3'), DNA (5'-D(*GP*CP*TP*GP*AP*TP*GP*CP*GP*CP*(C7R))-3'), DNA (5'-D(P*GP*TP*CP*GP*G)-3'), ... | | Authors: | Freudenthal, B.D, Wilson, S.H, Beard, W.A. | | Deposit date: | 2016-12-16 | | Release date: | 2017-02-08 | | Last modified: | 2023-10-04 | | Method: | X-RAY DIFFRACTION (1.85 Å) | | Cite: | Revealing the role of the product metal in DNA polymerase beta catalysis.
Nucleic Acids Res., 45, 2017
|
|
6PH6
 | |
8K8S
 | | F8-A22-E4 complex of MPXV in complex with DNA and Ara-CTP | | Descriptor: | 4-amino-1-{5-O-[(S)-hydroxy{[(R)-hydroxy(phosphonooxy)phosphoryl]oxy}phosphoryl]-beta-D-arabinofuranosyl}pyrimidin-2(1H)-one, DNA (5'-D(*AP*TP*CP*CP*TP*CP*CP*CP*CP*TP*AP*C)-3'), DNA (5'-D(P*TP*AP*GP*GP*TP*AP*GP*GP*GP*GP*AP*GP*GP*AP*T)-3'), ... | | Authors: | Shen, Y.P, Li, Y.N, Yan, R.H. | | Deposit date: | 2023-07-31 | | Release date: | 2024-06-05 | | Last modified: | 2024-06-19 | | Method: | ELECTRON MICROSCOPY (3.06 Å) | | Cite: | Structural basis for the inhibition mechanism of the DNA polymerase holoenzyme from mpox virus.
Structure, 32, 2024
|
|
8K8U
 | | F8-A22-E4 complex of MPXV in complex with DNA and dCTP | | Descriptor: | CYTIDINE-5'-TRIPHOSPHATE, DNA (5'-D(*AP*TP*CP*CP*TP*CP*CP*CP*CP*TP*AP*C)-3'), DNA (5'-D(P*AP*AP*GP*GP*TP*AP*GP*GP*GP*GP*AP*GP*GP*AP*T)-3'), ... | | Authors: | Shen, Y.P, Li, Y.N, Yan, R.H. | | Deposit date: | 2023-07-31 | | Release date: | 2024-06-05 | | Last modified: | 2024-06-19 | | Method: | ELECTRON MICROSCOPY (3.05 Å) | | Cite: | Structural basis for the inhibition mechanism of the DNA polymerase holoenzyme from mpox virus.
Structure, 32, 2024
|
|
8J8G
 | | Monkeypox virus DNA replication holoenzyme F8, A22 and E4 in complex with a DNA duplex and cidofovir diphosphate | | Descriptor: | CALCIUM ION, DNA (5'-D(P*AP*GP*CP*TP*GP*CP*TP*AP*TP*GP*AP*GP*AP*TP*TP*AP*AP*GP*TP*TP*AP*T)-3'), DNA (5'-D(P*GP*TP*TP*TP*TP*TP*TP*TP*TP*TP*TP*TP*TP*GP*AP*TP*AP*AP*CP*TP*TP*AP*AP*TP*CP*TP*CP*AP*CP*AP*TP*AP*GP*CP*AP*GP*CP*T)-3'), ... | | Authors: | Xu, Y, Wu, Y, Wu, X, Zhang, Y, Yang, Y, Li, D, Yang, B, Gao, K, Zhang, Z, Dong, C. | | Deposit date: | 2023-05-01 | | Release date: | 2024-05-08 | | Last modified: | 2024-06-05 | | Method: | ELECTRON MICROSCOPY (2.79 Å) | | Cite: | Structural basis of human mpox viral DNA replication inhibition by brincidofovir and cidofovir.
Int.J.Biol.Macromol., 270, 2024
|
|
8J8F
 | | Monkeypox virus DNA replication holoenzyme F8, A22 and E4 in complex with a DNA duplex and dCTP | | Descriptor: | 2'-DEOXYCYTIDINE-5'-TRIPHOSPHATE, CALCIUM ION, DNA (5'-D(P*AP*GP*CP*TP*GP*CP*TP*AP*TP*GP*AP*GP*AP*TP*TP*AP*AP*GP*TP*TP*AP*T)-3'), ... | | Authors: | Xu, Y, Wu, Y, Wu, X, Zhang, Y, Yang, Y, Li, D, Yang, B, Gao, K, Zhang, Z, Dong, C. | | Deposit date: | 2023-05-01 | | Release date: | 2024-05-08 | | Last modified: | 2024-06-05 | | Method: | ELECTRON MICROSCOPY (2.98 Å) | | Cite: | Structural basis of human mpox viral DNA replication inhibition by brincidofovir and cidofovir.
Int.J.Biol.Macromol., 270, 2024
|
|
5E3L
 | |
5DTD
 | |
5E3M
 | | Crystal structure of Fis bound to 27bp DNA F35 (AAATTAGTTTGAATCTCGAGCTAATTT) | | Descriptor: | DNA (27-MER), DNA-binding protein Fis | | Authors: | Stella, S, Hancock, S.P, Cascio, D, Johnson, R.C. | | Deposit date: | 2015-10-03 | | Release date: | 2016-03-09 | | Last modified: | 2024-05-22 | | Method: | X-RAY DIFFRACTION (2.886 Å) | | Cite: | DNA Sequence Determinants Controlling Affinity, Stability and Shape of DNA Complexes Bound by the Nucleoid Protein Fis.
Plos One, 11, 2016
|
|
5DS9
 | |
5E3N
 | |
5E3O
 | |
5LUQ
 | | Crystal Structure of Human DNA-dependent Protein Kinase Catalytic Subunit (DNA-PKcs) | | Descriptor: | C-terminal fragment of KU80 (KU80ct194), DNA-dependent protein kinase catalytic subunit,DNA-dependent Protein Kinase Catalytic Subunit,DNA-dependent protein kinase catalytic subunit | | Authors: | Sibanda, B.L, Chirgadze, D.Y, Ascher, D.B, Blundell, T.L. | | Deposit date: | 2016-09-09 | | Release date: | 2017-02-15 | | Last modified: | 2018-03-28 | | Method: | X-RAY DIFFRACTION (4.3 Å) | | Cite: | DNA-PKcs structure suggests an allosteric mechanism modulating DNA double-strand break repair.
Science, 355, 2017
|
|
4TUG
 | | Crystal structure of MjMre11-DNA2 complex | | Descriptor: | DNA (5'-D(P*CP*TP*GP*TP*CP*CP*TP*AP*CP*GP*TP*GP*CP*CP*A)-3'), DNA (5'-D(P*GP*CP*AP*CP*GP*TP*AP*GP*GP*AP*CP*AP*GP*C)-3'), DNA double-strand break repair protein Mre11, ... | | Authors: | Sung, S, Cho, Y. | | Deposit date: | 2014-06-24 | | Release date: | 2014-10-15 | | Last modified: | 2023-12-27 | | Method: | X-RAY DIFFRACTION (3.55 Å) | | Cite: | DNA end recognition by the Mre11 nuclease dimer: insights into resection and repair of damaged DNA.
Embo J., 33, 2014
|
|
