5DTD

Crystal structure of Fis bound to 27bp DNA F1-8C (AAATTCGTTTGAATTTTGAGCGAATTT)

Summary for 5DTD

Entry DOI	10.2210/pdb5dtd/pdb
Descriptor	DNA-binding protein Fis, DNA (27-MER), ... (4 entities in total)
Functional Keywords	protein-dna complex, hth domain, dna bending, indirect recognition, dna binding protein-dna complex, dna binding protein/dna
Biological source	Escherichia coli More
Total number of polymer chains	4
Total formula weight	39092.63
Authors	Hancock, S.P.,Cascio, D.,Johnson, R.C. (deposition date: 2015-09-17, release date: 2016-03-09, Last modification date: 2023-09-27)
Primary citation	Hancock, S.P.,Stella, S.,Cascio, D.,Johnson, R.C. DNA Sequence Determinants Controlling Affinity, Stability and Shape of DNA Complexes Bound by the Nucleoid Protein Fis. Plos One, 11:e0150189-e0150189, 2016 Cited by PubMed: 26959646 DOI: 10.1371/journal.pone.0150189 PDB entries with the same primary citation
Experimental method	X-RAY DIFFRACTION (2.642 Å)

Structure validation