5DTD
Crystal structure of Fis bound to 27bp DNA F1-8C (AAATTCGTTTGAATTTTGAGCGAATTT)
Entity
| Entity ID | Chain ID | Description | Type | Chain length | Formula weight | Number of molecules | DB Name (Accession) | Biological source | Descriptive keywords |
| 1 | A, B (A, B) | DNA-binding protein Fis | polymer | 98 | 11252.9 | 2 | UniProt (P0A6R3) Pfam (PF02954) | Escherichia coli | Factor-for-inversion stimulation protein,Hin recombinational enhancer-binding protein |
| 2 | C (C) | DNA (27-MER) | polymer | 27 | 8335.4 | 1 | synthetic construct | ||
| 3 | D (D) | DNA (27-MER) | polymer | 27 | 8251.4 | 1 | synthetic construct | ||
| 4 | E, F, G (A, C, D) | water | water | 18.0 | 5 | Chemie (HOH) |
Sequence viewer
Contents of the asymmetric unit
| Polymers | Number of chains | 4 |
| Total formula weight | 39092.6 | |
| All* | Total formula weight | 39092.6 |






