5E3L
Crystal structure of Fis bound to 27bp DNA F1-8G (AAATTGGTTTGAATTTTGAGCCAATTT)
Summary for 5E3L
| Entry DOI | 10.2210/pdb5e3l/pdb |
| Related | 5DS9 5DTD 5E3M 5E3N 5E3O |
| Descriptor | DNA-binding protein Fis, DNA (27-MER), ... (4 entities in total) |
| Functional Keywords | protein-dna complex, hth domain, dna bending, indirect recognition, dna binding protein-dna complex, dna binding protein/dna |
| Biological source | Escherichia coli More |
| Total number of polymer chains | 4 |
| Total formula weight | 39092.63 |
| Authors | Hancock, S.P.,Cascio, D.,Johnson, R.C. (deposition date: 2015-10-03, release date: 2016-03-23, Last modification date: 2024-03-06) |
| Primary citation | Hancock, S.P.,Stella, S.,Cascio, D.,Johnson, R.C. DNA Sequence Determinants Controlling Affinity, Stability and Shape of DNA Complexes Bound by the Nucleoid Protein Fis. Plos One, 11:e0150189-e0150189, 2016 Cited by PubMed: 26959646DOI: 10.1371/journal.pone.0150189 PDB entries with the same primary citation |
| Experimental method | X-RAY DIFFRACTION (2.66 Å) |
Structure validation
Download full validation report
