PDB: 501 resultsInfo pagesStatus searchChemie searchBIRD

---

4KF6	Crystal structure of human ceramide-1-phosphate transfer protein (CPTP) in complex with 8:0 Ceramide-1-Phosphate (8:0-C1P) Descriptor: (2S,3R,4E)-3-hydroxy-2-(octanoylamino)octadec-4-en-1-yl dihydrogen phosphate, Glycolipid transfer protein domain-containing protein 1 Authors: Simanshu, D.K, Brown, R.E, Patel, D.J. Deposit date: 2013-04-26 Release date: 2013-07-17 Last modified: 2023-11-29 Method: X-RAY DIFFRACTION (3.195 Å) Cite: Non-vesicular trafficking by a ceramide-1-phosphate transfer protein regulates eicosanoids. Nature, 500, 2013
4W5Q	The Crystal Structure of Human Argonaute2 Bound to a Guide and Target RNA Containing Seed Pairing from 2-8 Descriptor: MAGNESIUM ION, PHENOL, Protein argonaute-2, ... Authors: Schirle, N.T, MacRae, I.J. Deposit date: 2014-08-18 Release date: 2014-11-12 Last modified: 2023-09-27 Method: X-RAY DIFFRACTION (3.101 Å) Cite: Gene regulation. Structural basis for microRNA targeting. Science, 346, 2014
7KI3	Human Argonaute2:miR-122 bound to the HCV genotype 1a site-1 RNA Descriptor: BARIUM ION, HCV genotype 1a miR-122 site-1, Protein argonaute-2, ... Authors: Gebert, L.F.R, MacRae, I.J. Deposit date: 2020-10-22 Release date: 2021-10-06 Last modified: 2023-10-18 Method: X-RAY DIFFRACTION (3 Å) Cite: A structured RNA motif locks Argonaute2:miR-122 onto the 5' end of the HCV genome. Nat Commun, 12, 2021
2Q1O	Crystal Structure Analysis of the RNA Dodecamer CGC-NF2-AAUUGGCG, with an Incorporated 2,4-Difluorotoluyl Residue (NF2) Descriptor: RNA (5'-R(*CP*GP*CP*(NF2)P*AP*AP*UP*UP*GP*GP*CP*G)-3') Authors: Li, F, Pallan, P.S. Deposit date: 2007-05-25 Release date: 2007-10-30 Last modified: 2024-04-03 Method: X-RAY DIFFRACTION (1.1 Å) Cite: Crystal structure, stability and in vitro RNAi activity of oligoribonucleotides containing the ribo-difluorotoluyl nucleotide: insights into substrate requirements by the human RISC Ago2 enzyme. Nucleic Acids Res., 35, 2007
2Q1R	Crystal Structure Analysis of the RNA Dodecamer CGCGAAUUAGCG, with a G-A mismatch. Descriptor: MAGNESIUM ION, RNA (5'-R(*CP*GP*CP*GP*AP*AP*UP*UP*AP*GP*CP*G)-3') Authors: Li, F, Pallan, P.S. Deposit date: 2007-05-25 Release date: 2007-10-30 Last modified: 2024-04-03 Method: X-RAY DIFFRACTION (1.12 Å) Cite: Crystal structure, stability and in vitro RNAi activity of oligoribonucleotides containing the ribo-difluorotoluyl nucleotide: insights into substrate requirements by the human RISC Ago2 enzyme. Nucleic Acids Res., 35, 2007
7ROZ	Structure of RNA-dependent RNA polymerase 2 (RDR2) from Arabidopsis thaliana Descriptor: MAGNESIUM ION, RNA-dependent RNA polymerase 2 Authors: Fukudome, A, Pikaard, C.S, Takagi, Y. Deposit date: 2021-08-02 Release date: 2021-12-08 Last modified: 2024-06-05 Method: ELECTRON MICROSCOPY (3.1 Å) Cite: Structure and RNA template requirements of Arabidopsis RNA-DEPENDENT RNA POLYMERASE 2. Proc.Natl.Acad.Sci.USA, 118, 2021
7RQS	Arabidopsis RNA-dependent RNA polymerase 2 Descriptor: MAGNESIUM ION, RNA-dependent RNA polymerase 2 Authors: Fukudome, A, Pikaard, C.S, Takagi, Y. Deposit date: 2021-08-07 Release date: 2021-12-08 Last modified: 2024-06-05 Method: ELECTRON MICROSCOPY (3.57 Å) Cite: Structure and RNA template requirements of Arabidopsis RNA-DEPENDENT RNA POLYMERASE 2. Proc.Natl.Acad.Sci.USA, 118, 2021
4W5R	The Crystal Structure of Human Argonaute2 Bound to a Guide and Target RNA Containing Seed Pairing from 2-8 (Long Target) Descriptor: ISOPROPYL ALCOHOL, MAGNESIUM ION, PHENOL, ... Authors: Schirle, N.T, MacRae, I.J. Deposit date: 2014-08-18 Release date: 2014-11-12 Last modified: 2023-09-27 Method: X-RAY DIFFRACTION (2.5 Å) Cite: Gene regulation. Structural basis for microRNA targeting. Science, 346, 2014
4W5N	The Crystal Structure of Human Argonaute2 Bound to a Defined Guide RNA Descriptor: MAGNESIUM ION, PHENOL, Protein argonaute-2, ... Authors: Schirle, N.T, Sheu-Gruttadauria, J, MacRae, I.J. Deposit date: 2014-08-18 Release date: 2014-11-12 Last modified: 2023-09-27 Method: X-RAY DIFFRACTION (2.9 Å) Cite: Gene regulation. Structural basis for microRNA targeting. Science, 346, 2014
4W5O	The Crystal Structure of Human Argonaute2 Bound to a Guide and Target RNA Containing Seed Pairing from 2-9 Descriptor: ISOPROPYL ALCOHOL, MAGNESIUM ION, PHENOL, ... Authors: Schirle, N.T, MacRae, I.J. Deposit date: 2014-08-18 Release date: 2014-11-12 Last modified: 2023-09-27 Method: X-RAY DIFFRACTION (1.802 Å) Cite: Gene regulation. Structural basis for microRNA targeting. Science, 346, 2014
4W5T	The Crystal Structure of Human Argonaute2 Bound to a Guide and Target RNA Containing Seed Pairing from 2-7 Descriptor: MAGNESIUM ION, PHENOL, Protein argonaute-2, ... Authors: Schirle, N.T, MacRae, I.J. Deposit date: 2014-08-18 Release date: 2014-11-12 Last modified: 2023-09-27 Method: X-RAY DIFFRACTION (2.5 Å) Cite: Gene regulation. Structural basis for microRNA targeting. Science, 346, 2014
5T7B	Argonaute-2 - 5'-(E)-vinylphosphonate 2'-O-methyl-uridine modified mrTTR guide RNA complex Descriptor: PHENOL, Protein argonaute-2, RNA (UVP)UAUAGAGCAAGAACACUGUU Authors: Elkayam, E, Joshua-Tor, L. Deposit date: 2016-09-02 Release date: 2016-12-14 Last modified: 2023-10-04 Method: X-RAY DIFFRACTION (2.529 Å) Cite: Protein structure To Be Published
5THE	Crystal structure of the C-terminal lobe of a budding yeast Argonaute Descriptor: RNA (5'-R(P*UP*AP*AP*AP*AP*AP*AP*A)-3'), Uncharacterized protein Authors: Dayeh, D.M, Nakanishi, K. Deposit date: 2016-09-29 Release date: 2018-03-14 Last modified: 2023-10-04 Method: X-RAY DIFFRACTION (2.097 Å) Cite: Structural and functional analyses reveal the contributions of the C- and N-lobes of Argonaute protein to selectivity of RNA target cleavage. J. Biol. Chem., 293, 2018
8HYJ	A cryo-EM structure of KTF1-bound polymerase V transcription elongation complex Descriptor: DNA (48-MER), DNA-directed RNA polymerase V subunit 1, DNA-directed RNA polymerase V subunit 5A, ... Authors: Zhang, H, Zhang, Y. Deposit date: 2023-01-06 Release date: 2023-06-21 Last modified: 2024-05-29 Method: ELECTRON MICROSCOPY (4.3 Å) Cite: A cryo-EM structure of KTF1-bound polymerase V transcription elongation complex. Nat Commun, 14, 2023
3KNC	Crystal structure of the CeNA-RNA hybrid octamer ce(GCGTAGCG):r(CGCUACGC) Descriptor: 5'-D(*(XGR)P*(XCR)P*(XGR)P*(XTR)P*(XAR)P*(XGR)P*(XCR)P*(XGR)P*(XGR))-3', 5'-R(*CP*GP*CP*UP*AP*CP*GP*C)-3', MAGNESIUM ION Authors: Ovaere, M, Van Meervelt, L. Deposit date: 2009-11-12 Release date: 2010-12-08 Last modified: 2024-02-21 Method: X-RAY DIFFRACTION (2.5 Å) Cite: The Crystal Structure of the CeNA:RNA Hybrid ce(GCGTAGCG):r(CGCUACGC). Chemistry, 17, 2011
6NIT	Human Argonaute2-miR-122 bound to a target RNA with four central mismatches (bu4) Descriptor: Protein argonaute-2, RNA (5'-R(P*AP*AP*CP*AP*CP*CP*AP*UP*CP*CP*AP*AP*CP*AP*CP*UP*CP*CP*AP*AP*A)-3'), RNA (5'-R(P*UP*GP*GP*AP*GP*UP*GP*UP*GP*AP*CP*AP*AP*UP*GP*GP*UP*GP*UP*UP*U)-3') Authors: Sheu-Gruttadauria, J, MacRae, I.J. Deposit date: 2018-12-31 Release date: 2019-08-07 Last modified: 2024-03-13 Method: X-RAY DIFFRACTION (3.8 Å) Cite: Structural Basis for Target-Directed MicroRNA Degradation. Mol.Cell, 75, 2019
5WEA	Human Argonaute2 Helix-7 Mutant Descriptor: PHENOL, Protein argonaute-2, RNA (5'-R(P*AP*AP*AP*AP*AP*AP*AP*U)-3') Authors: Schirle, N.T, Klum, S.M, MacRae, I.J. Deposit date: 2017-07-08 Release date: 2017-11-22 Last modified: 2023-10-04 Method: X-RAY DIFFRACTION (3.12 Å) Cite: Helix-7 in Argonaute2 shapes the microRNA seed region for rapid target recognition. EMBO J., 37, 2018
1R6Z	The Crystal Structure of the Argonaute2 PAZ domain (as a MBP fusion) Descriptor: Chimera of Maltose-binding periplasmic protein and Argonaute 2, NICKEL (II) ION, alpha-D-glucopyranose-(1-4)-alpha-D-glucopyranose Authors: Song, J.J, Liu, J, Tolia, N.H, Schneiderman, J, Smith, S.K, Martienssen, R.A, Hannon, G.J, Joshua-Tor, L. Deposit date: 2003-10-17 Release date: 2004-01-13 Last modified: 2023-08-23 Method: X-RAY DIFFRACTION (2.8 Å) Cite: The crystal structure of the Argonaute2 PAZ domain reveals an RNA binding motif in RNAi effector complexes. Nat.Struct.Biol., 10, 2003
6CBD	Crystal Structure of Human Argonaute2 Bound to Three Tryptophans Descriptor: Guide RNA, ISOPROPYL ALCOHOL, MAGNESIUM ION, ... Authors: Sheu-Gruttadauria, J, MacRae, I.J. Deposit date: 2018-02-02 Release date: 2018-04-18 Last modified: 2024-03-13 Method: X-RAY DIFFRACTION (2.203 Å) Cite: Phase Transitions in the Assembly and Function of Human miRISC. Cell, 173, 2018
3G7L	Chromodomain of Chp1 in complex with Histone H3K9me3 peptide Descriptor: ACETIC ACID, Chromo domain-containing protein 1, Histone H3.1/H3.2, ... Authors: Schalch, T, Joshua-Tor, L. Deposit date: 2009-02-10 Release date: 2009-04-21 Last modified: 2023-09-06 Method: X-RAY DIFFRACTION (2.2 Å) Cite: High-affinity binding of Chp1 chromodomain to K9 methylated histone H3 is required to establish centromeric heterochromatin Mol.Cell, 34, 2009
4Z4F	Human Argonaute2 Bound to t1-DAP Target RNA Descriptor: MAGNESIUM ION, PHENOL, Protein argonaute-2, ... Authors: Schirle, N.T, MacRae, I.J. Deposit date: 2015-04-02 Release date: 2015-09-23 Last modified: 2023-09-27 Method: X-RAY DIFFRACTION (2.8 Å) Cite: Water-mediated recognition of t1-adenosine anchors Argonaute2 to microRNA targets. Elife, 4, 2015
4Z4D	Human Argonaute2 Bound to t1-G Target RNA Descriptor: ISOPROPYL ALCOHOL, MAGNESIUM ION, PHENOL, ... Authors: Schirle, N.T, MacRae, I.J. Deposit date: 2015-04-02 Release date: 2015-09-23 Last modified: 2023-09-27 Method: X-RAY DIFFRACTION (1.6 Å) Cite: Water-mediated recognition of t1-adenosine anchors Argonaute2 to microRNA targets. Elife, 4, 2015
4Z4C	Human Argonaute2 Bound to t1-C Target RNA Descriptor: ISOPROPYL ALCOHOL, MAGNESIUM ION, PHENOL, ... Authors: Schirle, N.T, MacRae, I.J. Deposit date: 2015-04-02 Release date: 2015-09-23 Last modified: 2024-03-06 Method: X-RAY DIFFRACTION (2.303 Å) Cite: Water-mediated recognition of t1-adenosine anchors Argonaute2 to microRNA targets. Elife, 4, 2015
4Z4E	Human Argonaute2 Bound to t1-U Target RNA Descriptor: ISOPROPYL ALCOHOL, MAGNESIUM ION, PHENOL, ... Authors: Schirle, N.T, MacRae, I.J. Deposit date: 2015-04-02 Release date: 2015-09-23 Last modified: 2023-09-27 Method: X-RAY DIFFRACTION (1.8 Å) Cite: Water-mediated recognition of t1-adenosine anchors Argonaute2 to microRNA targets. Elife, 4, 2015
4Z4G	Human Argonaute2 Bound to t1-Inosine Target RNA Descriptor: MAGNESIUM ION, PHENOL, Protein argonaute-2, ... Authors: Schirle, N.T, MacRae, I.J. Deposit date: 2015-04-02 Release date: 2015-09-23 Last modified: 2023-09-27 Method: X-RAY DIFFRACTION (2.7 Å) Cite: Water-mediated recognition of t1-adenosine anchors Argonaute2 to microRNA targets. Elife, 4, 2015

<6789101112131415161718192021>