PDB: 245396 resultsInfo pagesStatus searchChemie searchBIRD

---

1B5G	HUMAN THROMBIN COMPLEXED WITH NOVEL SYNTHETIC PEPTIDE MIMETIC INHIBITOR AND HIRUGEN Descriptor: ALPHA-THROMBIN, HIRUGEN, SODIUM ION, ... Authors: St Charles, R, Tulinsky, A, Kahn, M. Deposit date: 1998-03-05 Release date: 1998-05-27 Last modified: 2024-12-25 Method: X-RAY DIFFRACTION (2.07 Å) Cite: Bound structures of novel P3-P1' beta-strand mimetic inhibitors of thrombin. J.Med.Chem., 42, 1999
1TS9	Crystal Structure of the Archaeal Homolog of Human RNase P Protein Rpp29 from Archaeoglobus fulgidus Descriptor: Ribonuclease P protein component 1 Authors: Sidote, D.J, Heideker, J, Hoffman, D.W. Deposit date: 2004-06-21 Release date: 2004-10-12 Last modified: 2024-10-30 Method: X-RAY DIFFRACTION (1.7 Å) Cite: Crystal structure of archaeal ribonuclease P protein aRpp29 from Archaeoglobus fulgidus. Biochemistry, 43, 2004
6N6R	Crystal structure of ABIN-1 UBAN in complex with two M1-linked di-ubiquitins Descriptor: TNFAIP3-interacting protein 1, Ubiquitin Authors: Rahighi, S, Dikic, I, Wakatsuki, S. Deposit date: 2018-11-27 Release date: 2019-07-17 Last modified: 2024-03-13 Method: X-RAY DIFFRACTION (1.95 Å) Cite: Molecular Recognition of M1-Linked Ubiquitin Chains by Native and Phosphorylated UBAN Domains. J.Mol.Biol., 431, 2019
3K97	HSP90 N-terminal domain in complex with 4-chloro-6-{[(2R)-2-(2-methylphenyl)pyrrolidin-1-yl]carbonyl}benzene-1,3-diol Descriptor: 4-chloro-6-{[(2R)-2-(2-methylphenyl)pyrrolidin-1-yl]carbonyl}benzene-1,3-diol, DIMETHYL SULFOXIDE, Heat shock protein HSP 90-alpha Authors: Gajiwala, K.S. Deposit date: 2009-10-15 Release date: 2010-02-09 Last modified: 2024-02-21 Method: X-RAY DIFFRACTION (1.95 Å) Cite: Dihydroxyphenylisoindoline amides as orally bioavailable inhibitors of the heat shock protein 90 (hsp90) molecular chaperone. J.Med.Chem., 53, 2010
1NHK	CRYSTAL STRUCTURE OF MYXOCOCCUS XANTHUS NUCLEOSIDE DIPHOSPHATE KINASE AND ITS INTERACTION WITH A NUCLEOTIDE SUBSTRATE AT 2.0 ANGSTROMS RESOLUTION Descriptor: ADENOSINE-3',5'-CYCLIC-MONOPHOSPHATE, NUCLEOSIDE DIPHOSPHATE KINASE Authors: Strelkov, S, Williams, R.L. Deposit date: 1994-12-09 Release date: 1995-03-31 Last modified: 2024-02-14 Method: X-RAY DIFFRACTION (1.9 Å) Cite: The 1.9 A crystal structure of a nucleoside diphosphate kinase complex with adenosine 3',5'-cyclic monophosphate: evidence for competitive inhibition. J.Mol.Biol., 249, 1995
7GAU	PanDDA analysis group deposition of ground-state model of MAP1LC3B Descriptor: 1,2-ETHANEDIOL, CHLORIDE ION, Microtubule-associated proteins 1A/1B light chain 3B Authors: Kumar, A, Marples, P.G, Tomlinson, C.W.E, Fearon, D, von-Delft, F, Knapp, S, Structural Genomics Consortium (SGC) Deposit date: 2023-08-11 Release date: 2024-09-04 Method: X-RAY DIFFRACTION (1.59 Å) Cite: PanDDA analysis group deposition of ground-state model To Be Published
3JQM	Binding of 5'-GTP to molybdenum cofactor biosynthesis protein MoaC from Thermus theromophilus HB8 Descriptor: 1,2-ETHANEDIOL, CITRATE ANION, DI(HYDROXYETHYL)ETHER, ... Authors: Kanaujia, S.P, Jeyakanthan, J, Nakagawa, N, Sekar, K, Shinkai, A, Kuramitsu, S, Yokoyama, S, RIKEN Structural Genomics/Proteomics Initiative (RSGI) Deposit date: 2009-09-07 Release date: 2010-06-30 Last modified: 2023-11-01 Method: X-RAY DIFFRACTION (2.5 Å) Cite: Structures of apo and GTP-bound molybdenum cofactor biosynthesis protein MoaC from Thermus thermophilus HB8 Acta Crystallogr.,Sect.D, 66, 2010
1PB9	CRYSTAL STRUCTURE OF THE NR1 LIGAND BINDING CORE IN COMPLEX WITH D-CYCLOSERINE AT 1.60 ANGSTROMS RESOLUTION Descriptor: (R)-4-AMINO-ISOXAZOLIDIN-3-ONE, N-methyl-D-aspartate Receptor Subunit 1 Authors: Furukawa, H, Gouaux, E. Deposit date: 2003-05-14 Release date: 2003-06-24 Last modified: 2024-10-30 Method: X-RAY DIFFRACTION (1.6 Å) Cite: Mechanisms of activation, inhibition and specificity: crystal structures of the NMDA receptor NR1 ligand-binding core Embo J., 22, 2003
3V1S	Scaffold tailoring by a newly detected Pictet-Spenglerase ac-tivity of strictosidine synthase (STR1): from the common tryp-toline skeleton to the rare piperazino-indole framework Descriptor: 2-(1H-indol-1-yl)ethanamine, Strictosidine synthase Authors: Wu, F, Zhu, H, Sun, L, Rajendran, C, Wang, M, Ren, X, Panjikar, S, Cherkasov, A, Zou, H, Stoeckigt, J. Deposit date: 2011-12-10 Release date: 2012-02-29 Last modified: 2024-10-30 Method: X-RAY DIFFRACTION (2.328 Å) Cite: Scaffold Tailoring by a Newly Detected Pictet-Spenglerase Activity of Strictosidine Synthase: From the Common Tryptoline Skeleton to the Rare Piperazino-indole Framework J.Am.Chem.Soc., 134, 2012
3SGX	Crystal Structure of E. coli undecaprenyl pyrophosphate synthase in complex with BPH-1100 Descriptor: 4-{3-[(biphenyl-4-ylcarbonyl)amino]phenoxy}benzene-1,2-dicarboxylic acid, Undecaprenyl pyrophosphate synthase Authors: Cao, R, Liu, Y.-L, Oldfield, E. Deposit date: 2011-06-15 Release date: 2012-12-19 Last modified: 2023-09-13 Method: X-RAY DIFFRACTION (2.45 Å) Cite: Antibacterial drug leads targeting isoprenoid biosynthesis. Proc.Natl.Acad.Sci.USA, 110, 2013
4OMH	Crystal structure of the bacterial diterpene cyclase COTB2 variant F149L Descriptor: 3-CYCLOHEXYL-1-PROPYLSULFONIC ACID, Geranylgeranyl diphosphate cyclase, SODIUM ION Authors: Janke, R, Goerner, C, Hirte, M, Brueck, T, Loll, B. Deposit date: 2014-01-27 Release date: 2014-06-04 Last modified: 2024-02-28 Method: X-RAY DIFFRACTION (1.64 Å) Cite: The first structure of a bacterial diterpene cyclase: CotB2. Acta Crystallogr.,Sect.D, 70, 2014
4O8X	Zinc-bound Rpn11 in complex with Rpn8 Descriptor: 1,2-ETHANEDIOL, 26S proteasome regulatory subunit RPN11, 26S proteasome regulatory subunit RPN8, ... Authors: Worden, E.J, Padovani, C, Martin, A. Deposit date: 2013-12-30 Release date: 2014-01-22 Last modified: 2023-09-20 Method: X-RAY DIFFRACTION (1.991 Å) Cite: Structure of the Rpn11-Rpn8 dimer reveals mechanisms of substrate deubiquitination during proteasomal degradation. Nat.Struct.Mol.Biol., 21, 2014
1TQ9	Non-covalent swapped dimer of Bovine Seminal Ribonuclease in complex with 2'-DEOXYCYTIDINE-2'-DEOXYADENOSINE-3',5'-MONOPHOSPHATE Descriptor: 2'-DEOXYCYTIDINE-2'-DEOXYADENOSINE-3',5'-MONOPHOSPHATE, Ribonuclease, seminal Authors: Sica, F, Di Fiore, A, Merlino, A, Mazzarella, L. Deposit date: 2004-06-17 Release date: 2004-09-14 Last modified: 2023-10-25 Method: X-RAY DIFFRACTION (2 Å) Cite: Structure and Stability of the Non-covalent Swapped Dimer of Bovine Seminal Ribonuclease: AN ENZYME TAILORED TO EVADE RIBONUCLEASE PROTEIN INHIBITOR J.Biol.Chem., 279, 2004
2XYJ	Novel Sulfonylthiadiazoles with an Unusual Binding Mode as Partial Dual Peroxisome Proliferator-Activated Receptor (PPAR) gamma-delta Agonists with High Potency and In-vivo Efficacy Descriptor: 5-CHLORO-2-METHOXY-N-[2-[4-[(5-PROPAN-2-YL-1,3,4-THIADIAZOL-2-YL)SULFAMOYL]PHENYL]ETHYL]BENZAMIDE, PENTAETHYLENE GLYCOL, PEROXISOME PROLIFERATOR-ACTIVATED RECEPTOR DELTA Authors: Marquette, J.-P, Mathieu, M. Deposit date: 2010-11-18 Release date: 2011-02-23 Last modified: 2024-05-01 Method: X-RAY DIFFRACTION (2.3 Å) Cite: Sulfonylthiadiazoles with an Unusual Binding Mode as Partial Dual Peroxisome Proliferator-Activated Receptor (Ppar) Gamma / Delta Agonists with High Potency and in-Vivo Efficacy Chemmedchem, 6, 2011
4F1M	Crystal Structure of the G1179S Roco4 Kinase Domain bound to AppCp from D. discoideum. Descriptor: 2-[BIS-(2-HYDROXY-ETHYL)-AMINO]-2-HYDROXYMETHYL-PROPANE-1,3-DIOL, MAGNESIUM ION, PHOSPHOMETHYLPHOSPHONIC ACID ADENYLATE ESTER, ... Authors: Gilsbach, B.K, Vetter, I.R, Wittinghofer, A, Kortholt, A. Deposit date: 2012-05-07 Release date: 2012-06-27 Last modified: 2023-09-13 Method: X-RAY DIFFRACTION (2.04 Å) Cite: Roco kinase structures give insights into the mechanism of Parkinson disease-related leucine-rich-repeat kinase 2 mutations. Proc.Natl.Acad.Sci.USA, 109, 2012
4CIM	Complex of a Bcl-w BH3 mutant with a BH3 domain Descriptor: 1,2-ETHANEDIOL, BCL-2-LIKE PROTEIN 2 Authors: Colman, P.M, Lee, E.F, Fairlie, W.D. Deposit date: 2013-12-12 Release date: 2014-11-12 Last modified: 2023-12-20 Method: X-RAY DIFFRACTION (1.5 Å) Cite: The Functional Differences of Pro-Survival and Pro-Apoptotic B Cell Lymphoma 2 (Bcl-2) Proteins Depend on Structural Differences in Their Bcl-2 Homology 3 (Bh3) Domains J.Biol.Chem., 289, 2014
3HCN	Hg and protoporphyrin bound Human Ferrochelatase Descriptor: BICARBONATE ION, CHOLIC ACID, FE2/S2 (INORGANIC) CLUSTER, ... Authors: Medlock, A.E, Dailey, H.A, Lanzilotta, W.N. Deposit date: 2009-05-06 Release date: 2009-11-10 Last modified: 2024-02-21 Method: X-RAY DIFFRACTION (1.6 Å) Cite: Product release rather than chelation determines metal specificity for ferrochelatase. J.Mol.Biol., 393, 2009
7YWK	Crystal structure of an engineered TycA variant, TycApPLA, in complex with AMP Descriptor: 2-[BIS-(2-HYDROXY-ETHYL)-AMINO]-2-HYDROXYMETHYL-PROPANE-1,3-DIOL, ADENOSINE MONOPHOSPHATE, CHLORIDE ION, ... Authors: Mittl, P, Camus, A, Truong, G, Markert, G, Hilvert, D. Deposit date: 2022-02-14 Release date: 2022-09-21 Last modified: 2024-01-31 Method: X-RAY DIFFRACTION (1.39 Å) Cite: Reprogramming Nonribosomal Peptide Synthetases for Site-Specific Insertion of alpha-Hydroxy Acids. J.Am.Chem.Soc., 144, 2022
5T7B	Argonaute-2 - 5'-(E)-vinylphosphonate 2'-O-methyl-uridine modified mrTTR guide RNA complex Descriptor: PHENOL, Protein argonaute-2, RNA (UVP)UAUAGAGCAAGAACACUGUU Authors: Elkayam, E, Joshua-Tor, L. Deposit date: 2016-09-02 Release date: 2016-12-14 Last modified: 2023-10-04 Method: X-RAY DIFFRACTION (2.529 Å) Cite: Protein structure To Be Published
3V6O	Leptin Receptor-antibody complex Descriptor: 1,2-ETHANEDIOL, 2-acetamido-2-deoxy-beta-D-glucopyranose, ACETATE ION, ... Authors: Carpenter, B, Hemsworth, G.R, Ross, R.J, Artymiuk, P.J. Deposit date: 2011-12-20 Release date: 2012-03-14 Last modified: 2024-10-16 Method: X-RAY DIFFRACTION (1.95 Å) Cite: Structure of the human obesity receptor leptin-binding domain reveals the mechanism of leptin antagonism by a monoclonal antibody. Structure, 20, 2012
1BLC	INHIBITION OF BETA-LACTAMASE BY CLAVULANATE: TRAPPED INTERMEDIATES IN CRYOCRYSTALLOGRAPHIC STUDIES Descriptor: BETA-LACTAMASE, N-(1-CARBOXY-2-HYDROXY-4-OXO-BUTYL)-N-(3-OXO-CISPROPENYL)AMINE, N-(2-HYDROXY-4-OXO-BUTYL)-N-(3-OXO-TRANSPROPENYL)AMINE, ... Authors: Chen, C.C.H, Herzberg, O. Deposit date: 1993-09-27 Release date: 1994-01-31 Last modified: 2024-10-16 Method: X-RAY DIFFRACTION (2.2 Å) Cite: Inhibition of beta-lactamase by clavulanate. Trapped intermediates in cryocrystallographic studies. J.Mol.Biol., 224, 1992
5TE0	Crystal Structure of Adaptor Protein 2 Associated Kinase (AAK1) in complex with BIBF 1120 Descriptor: AP2-associated protein kinase 1, DI(HYDROXYETHYL)ETHER, GLYCEROL, ... Authors: Counago, R.M, Elkins, J.M, Bountra, C, Arruda, P, Edwards, A.M, Gileadi, O, Structural Genomics Consortium (SGC) Deposit date: 2016-09-20 Release date: 2016-11-02 Last modified: 2023-10-04 Method: X-RAY DIFFRACTION (1.9 Å) Cite: Crystal Structure of Adaptor Protein 2 Associated Kinase (AAK1) in complex with BIBF 1120 To Be Published
5S4C	PanDDA analysis group deposition -- Crystal Structure of SARS-CoV-2 Nsp3 macrodomain in complex with Z1954800348 Descriptor: 1,4,5,6-tetrahydropyrimidin-2-amine, DIMETHYL SULFOXIDE, Non-structural protein 3 Authors: Fearon, D, Schuller, M, Rangel, V.L, Douangamath, A, Rack, J.G.M, Zhu, K, Aimon, A, Brandao-Neto, J, Dias, A, Dunnet, L, Gorrie-Stone, T.J, Powell, A.J, Krojer, T, Skyner, R, Thompson, W, Ahel, I, von Delft, F. Deposit date: 2020-11-02 Release date: 2021-01-13 Last modified: 2024-03-06 Method: X-RAY DIFFRACTION (1.01 Å) Cite: Fragment binding to the Nsp3 macrodomain of SARS-CoV-2 identified through crystallographic screening and computational docking. Sci Adv, 7, 2021
3HCP	Human ferrochelatase with Mn and deuteroporphyrin bound Descriptor: CHOLIC ACID, FE(III) DEUTEROPORPHYRIN IX, FE2/S2 (INORGANIC) CLUSTER, ... Authors: Medlock, A.E, Dailey, H.A, Lanzilotta, W.N. Deposit date: 2009-05-06 Release date: 2009-11-10 Last modified: 2024-02-21 Method: X-RAY DIFFRACTION (2 Å) Cite: Product release rather than chelation determines metal specificity for ferrochelatase. J.Mol.Biol., 393, 2009
1ZKD	X-Ray structure of the putative protein Q6N1P6 from Rhodopseudomonas palustris at the resolution 2.1 A , Northeast Structural Genomics Consortium target RpR58 Descriptor: DUF185 Authors: Kuzin, A.P, Yong, W, Vorobiev, S.M, Acton, T, Ma, L, Xiao, R, Montelione, G, Tong, L, Hunt, J.F, Northeast Structural Genomics Consortium (NESG) Deposit date: 2005-05-02 Release date: 2005-05-10 Last modified: 2024-11-06 Method: X-RAY DIFFRACTION (2.1 Å) Cite: X-Ray structure of the putative protein Q6N1P6 from Rhodopseudomonas palustris at the resolution 2.1 A , Northeast Structural Genomics Consortium target RpR58 To be Published

<2254225522562257225822592260226122622263226422652266226722682269>