2B5A
 
 | | C.BclI, Control Element of the BclI Restriction-Modification System | | Descriptor: | ACETIC ACID, C.BclI | | Authors: | Sawaya, M.R, Zhu, Z, Mersha, F, Chan, S.H, Dabur, R, Xu, S.Y, Balendiran, G.K. | | Deposit date: | 2005-09-28 | | Release date: | 2006-01-03 | | Last modified: | 2024-02-14 | | Method: | X-RAY DIFFRACTION (1.543 Å) | | Cite: | Crystal Structure of the Restriction-Modification System Control Element C.BclI and Mapping of Its Binding Site.
Structure, 13, 2005
|
|
6GHC
 | | Modification dependent EcoKMcrA restriction endonuclease | | Descriptor: | 5-methylcytosine-specific restriction enzyme A, ZINC ION | | Authors: | Czapinska, H, Kowalska, M, Zagorskaite, E, Manakova, E, Xu, S, Siksnys, V, Sasnauskas, G, Bochtler, M. | | Deposit date: | 2018-05-07 | | Release date: | 2018-08-08 | | Last modified: | 2024-05-15 | | Method: | X-RAY DIFFRACTION (2.85 Å) | | Cite: | Activity and structure of EcoKMcrA.
Nucleic Acids Res., 46, 2018
|
|
6GHS
 | | Modification dependent TagI restriction endonuclease | | Descriptor: | SODIUM ION, TagI restriction endonuclease, ZINC ION | | Authors: | Kisiala, M, Copelas, A, Czapinska, H, Xu, S, Bochtler, M. | | Deposit date: | 2018-05-08 | | Release date: | 2018-08-29 | | Last modified: | 2024-01-17 | | Method: | X-RAY DIFFRACTION (2.92 Å) | | Cite: | Crystal structure of the modification-dependent SRA-HNH endonuclease TagI.
Nucleic Acids Res., 46, 2018
|
|
8RZ3
 | | Structures of Se- glycosyltransferase SenB from Variovorax paradoxus | | Descriptor: | TIGR04348 family glycosyltransferase, URIDINE-DIPHOSPHATE-N-ACETYLGLUCOSAMINE | | Authors: | Ma, Y.Y, Gao, Y, Xu, S.H. | | Deposit date: | 2024-02-12 | | Release date: | 2024-09-11 | | Last modified: | 2024-09-18 | | Method: | X-RAY DIFFRACTION (2.15 Å) | | Cite: | Structures of SenB and SenA enzymes from Variovorax paradoxus provide insights into carbon-selenium bond formation in selenoneine biosynthesis.
Heliyon, 10, 2024
|
|
8RYZ
 | | Structures of selenoneine synthase SenA from Variovorax paradoxus | | Descriptor: | 2-[N-CYCLOHEXYLAMINO]ETHANE SULFONIC ACID, GLYCEROL, IMIDAZOLE, ... | | Authors: | Ma, Y.Y, Gao, Y, Xu, S.H. | | Deposit date: | 2024-02-11 | | Release date: | 2024-09-11 | | Last modified: | 2024-09-18 | | Method: | X-RAY DIFFRACTION (2.02 Å) | | Cite: | Structures of SenB and SenA enzymes from Variovorax paradoxus provide insights into carbon-selenium bond formation in selenoneine biosynthesis.
Heliyon, 10, 2024
|
|
6YEX
 | | VcaM4I restriction endonuclease in the absence of DNA | | Descriptor: | CHLORIDE ION, HNH endonuclease, SULFATE ION | | Authors: | Pastor, M, Czapinska, H, Lutz, T, Helbrecht, I, Xu, S, Bochtler, M. | | Deposit date: | 2020-03-25 | | Release date: | 2020-12-16 | | Last modified: | 2024-05-15 | | Method: | X-RAY DIFFRACTION (1.5 Å) | | Cite: | Crystal structures of the EVE-HNH endonuclease VcaM4I in the presence and absence of DNA.
Nucleic Acids Res., 49, 2021
|
|
6YMG
 | | VcaM4I restriction endonuclease in complex with 5mC-modified dsDNA | | Descriptor: | CHLORIDE ION, DNA (5'-D(*CP*CP*AP*TP*GP*(5CM)P*GP*CP*TP*GP*A)-3'), DNA (5'-D(P*CP*AP*GP*CP*GP*CP*AP*TP*GP*G)-3'), ... | | Authors: | Pastor, M, Czapinska, H, Lutz, T, Helbrecht, I, Xu, S, Bochtler, M. | | Deposit date: | 2020-04-08 | | Release date: | 2020-12-23 | | Last modified: | 2024-01-24 | | Method: | X-RAY DIFFRACTION (3.14 Å) | | Cite: | Crystal structures of the EVE-HNH endonuclease VcaM4I in the presence and absence of DNA.
Nucleic Acids Res., 49, 2021
|
|
6YJB
 | | VcaM4I restriction endonuclease 5hmC-ssDNA complex | | Descriptor: | CHLORIDE ION, DNA (5'-D(*CP*AP*(5HC)P*AP*G)-3'), GLYCEROL, ... | | Authors: | Pastor, M, Czapinska, H, Lutz, T, Helbrecht, I, Xu, S, Bochtler, M. | | Deposit date: | 2020-04-02 | | Release date: | 2020-12-23 | | Last modified: | 2024-01-24 | | Method: | X-RAY DIFFRACTION (1.55 Å) | | Cite: | Crystal structures of the EVE-HNH endonuclease VcaM4I in the presence and absence of DNA.
Nucleic Acids Res., 49, 2021
|
|
6YKF
 | | VcaM4I restriction endonuclease in the presence of 5mC-modified ssDNA | | Descriptor: | CHLORIDE ION, DNA (5'-D(*CP*AP*(5CM)P*AP*G)-3'), GLYCEROL, ... | | Authors: | Pastor, M, Czapinska, H, Lutz, T, Helbrecht, I, Xu, S, Bochtler, M. | | Deposit date: | 2020-04-06 | | Release date: | 2020-12-23 | | Last modified: | 2024-01-24 | | Method: | X-RAY DIFFRACTION (1.48 Å) | | Cite: | Crystal structures of the EVE-HNH endonuclease VcaM4I in the presence and absence of DNA.
Nucleic Acids Res., 49, 2021
|
|
7YQE
 | |
1DC1
 | | RESTRICTION ENZYME BSOBI/DNA COMPLEX STRUCTURE: ENCIRCLEMENT OF THE DNA AND HISTIDINE-CATALYZED HYDROLYSIS WITHIN A CANONICAL RESTRICTION ENZYME FOLD | | Descriptor: | 1,4-DIETHYLENE DIOXIDE, BSOBI RESTRICTION ENDONUCLEASE, DNA (5'-D(*T*AP*TP*AP*CP*TP*CP*GP*AP*GP*TP*AP*T)-3') | | Authors: | van der Woerd, M.J, Pelletier, J.J, Xu, S.-Y, Friedman, A.M. | | Deposit date: | 1999-11-04 | | Release date: | 2001-02-21 | | Last modified: | 2024-02-07 | | Method: | X-RAY DIFFRACTION (1.7 Å) | | Cite: | Restriction enzyme BsoBI-DNA complex: a tunnel for recognition of degenerate DNA sequences and potential histidine catalysis.
Structure, 9, 2001
|
|
7R7Z
 | | Crystal structure of QW9-HLA-B*5301 specific T Cell Receptor, C3 | | Descriptor: | Alpha chain of C3 TCR, Beta chain of C3 TCR, HEXAETHYLENE GLYCOL, ... | | Authors: | Li, X.L, Tan, K.M, Xu, S.T, Ng, R, Walker, B.D, Wang, J.H. | | Deposit date: | 2021-06-25 | | Release date: | 2022-06-29 | | Last modified: | 2023-10-25 | | Method: | X-RAY DIFFRACTION (2.286 Å) | | Cite: | Molecular basis of differential HLA class I-restricted T cell recognition of a highly networked HIV peptide.
Nat Commun, 14, 2023
|
|
3R5S
 | | Crystal structure of apo-ViuP | | Descriptor: | Ferric vibriobactin ABC transporter, periplasmic ferric vibriobactin-binding protein | | Authors: | Li, N, Zhang, C, Li, B, Liu, X, Huang, Y, Xu, S, Gu, L. | | Deposit date: | 2011-03-19 | | Release date: | 2012-02-08 | | Last modified: | 2024-10-30 | | Method: | X-RAY DIFFRACTION (1.791 Å) | | Cite: | Unique iron coordination in iron-chelating molecule vibriobactin helps Vibrio cholerae evade mammalian siderocalin-mediated immune response.
J.Biol.Chem., 287, 2012
|
|
4ZCF
 | | Structural basis of asymmetric DNA methylation and ATP-triggered long-range diffusion by EcoP15I | | Descriptor: | ADENOSINE MONOPHOSPHATE, CALCIUM ION, DNA 20-mer AATCATAGTCTACTGCTGTA, ... | | Authors: | Gupta, Y.K, Chan, S.H, Xu, S.Y, Aggarwal, A.K. | | Deposit date: | 2015-04-15 | | Release date: | 2015-07-29 | | Last modified: | 2024-03-06 | | Method: | X-RAY DIFFRACTION (2.6 Å) | | Cite: | Structural basis of asymmetric DNA methylation and ATP-triggered long-range diffusion by EcoP15I.
Nat Commun, 6, 2015
|
|
5VQF
 | | Crystal Structure of pro-TGF-beta 1 | | Descriptor: | 2-acetamido-2-deoxy-beta-D-glucopyranose-(1-4)-2-acetamido-2-deoxy-beta-D-glucopyranose, Transforming growth factor beta-1, beta-D-mannopyranose-(1-4)-2-acetamido-2-deoxy-beta-D-glucopyranose-(1-4)-2-acetamido-2-deoxy-beta-D-glucopyranose | | Authors: | Zhao, B, Xu, S, Dong, X, Lu, C, Springer, T.A. | | Deposit date: | 2017-05-08 | | Release date: | 2017-11-15 | | Last modified: | 2024-10-23 | | Method: | X-RAY DIFFRACTION (2.9 Å) | | Cite: | Prodomain-growth factor swapping in the structure of pro-TGF-beta 1.
J. Biol. Chem., 293, 2018
|
|
5VQP
 | | Crystal structure of human pro-TGF-beta1 | | Descriptor: | Transforming growth factor beta-1, beta-D-mannopyranose-(1-4)-2-acetamido-2-deoxy-beta-D-glucopyranose-(1-4)-2-acetamido-2-deoxy-beta-D-glucopyranose | | Authors: | Zhao, B, Xu, S, Dong, X, Lu, C, Springer, T.A. | | Deposit date: | 2017-05-09 | | Release date: | 2017-11-15 | | Last modified: | 2023-10-04 | | Method: | X-RAY DIFFRACTION (2.9 Å) | | Cite: | Prodomain-growth factor swapping in the structure of pro-TGF-beta 1.
J. Biol. Chem., 293, 2018
|
|
3S1S
 | | Characterization and crystal structure of the type IIG restriction endonuclease BpuSI | | Descriptor: | 1,2-ETHANEDIOL, IODIDE ION, MANGANESE (II) ION, ... | | Authors: | Shen, B.W, Xu, D, Chan, S.-H, Zheng, Y, Zhu, Y, Xu, S.-Y, Stoddard, B.L. | | Deposit date: | 2011-05-16 | | Release date: | 2011-07-13 | | Last modified: | 2011-10-19 | | Method: | X-RAY DIFFRACTION (2.35 Å) | | Cite: | Characterization and crystal structure of the type IIG restriction endonuclease RM.BpuSI.
Nucleic Acids Res., 39, 2011
|
|
3TGV
 | | Crystal structure of HutZ,the heme storsge protein from Vibrio cholerae | | Descriptor: | BENZOIC ACID, Heme-binding protein HutZ | | Authors: | Liu, X, Gong, J, Wang, Z, Du, Q, Wei, T, Zhu, D, Huang, Y, Xu, S, Gu, L. | | Deposit date: | 2011-08-17 | | Release date: | 2012-08-22 | | Last modified: | 2023-11-01 | | Method: | X-RAY DIFFRACTION (1.999 Å) | | Cite: | Crystal structure of HutZ,the heme storsge protein from Vibrio cholerae
To be Published
|
|
3SFV
 | | Crystal structure of the GDP-bound Rab1a S25N mutant in complex with the coiled-coil domain of LidA from Legionella pneumophila | | Descriptor: | GUANOSINE-5'-DIPHOSPHATE, LidA protein, substrate of the Dot/Icm system, ... | | Authors: | Yin, K, Lu, D, Zhu, D, Zhang, H, Li, B, Xu, S, Gu, L. | | Deposit date: | 2011-06-14 | | Release date: | 2012-04-18 | | Last modified: | 2023-11-01 | | Method: | X-RAY DIFFRACTION (1.73 Å) | | Cite: | Structural Insights into a Unique Legionella pneumophila Effector LidA Recognizing Both GDP and GTP Bound Rab1 in Their Active State
Plos Pathog., 8, 2012
|
|
3O72
 | | Crystal structure of EfeB in complex with heme | | Descriptor: | OXYGEN MOLECULE, PROTOPORPHYRIN IX CONTAINING FE, Redox component of a tripartite ferrous iron transporter | | Authors: | Liu, X, Du, Q, Wang, Z, Zhu, D, Huang, Y, Li, N, Xu, S, Gu, L. | | Deposit date: | 2010-07-30 | | Release date: | 2011-03-16 | | Last modified: | 2017-11-08 | | Method: | X-RAY DIFFRACTION (1.95 Å) | | Cite: | Crystal structure and biochemical features of EfeB/YcdB from Escherichia coli O157: ASP235 plays divergent roles in different enzyme-catalyzed processes
J.Biol.Chem., 286, 2011
|
|
3R5T
 | | Crystal structure of holo-ViuP | | Descriptor: | (4S,5R)-N-{3-[(2,3-dihydroxybenzoyl)amino]propyl}-2-(2,3-dihydroxyphenyl)-N-[3-({[(4S,5R)-2-(2,3-dihydroxyphenyl)-5-met hyl-4,5-dihydro-1,3-oxazol-4-yl]carbonyl}amino)propyl]-5-methyl-4,5-dihydro-1,3-oxazole-4-carboxamide, 1,2-ETHANEDIOL, ACETIC ACID, ... | | Authors: | Li, N, Zhang, C, Li, B, Liu, X, Huang, Y, Xu, S, Gu, L. | | Deposit date: | 2011-03-19 | | Release date: | 2012-02-08 | | Last modified: | 2024-03-20 | | Method: | X-RAY DIFFRACTION (1.45 Å) | | Cite: | Unique iron coordination in iron-chelating molecule vibriobactin helps Vibrio cholerae evade mammalian siderocalin-mediated immune response.
J.Biol.Chem., 287, 2012
|
|
3TKL
 | | Crystal structure of the GTP-bound Rab1a in complex with the coiled-coil domain of LidA from Legionella pneumophila | | Descriptor: | GUANOSINE-5'-TRIPHOSPHATE, LidA protein, substrate of the Dot/Icm system, ... | | Authors: | Cheng, W, Yin, K, Lu, D, Li, B, Zhu, D, Chen, Y, Zhang, H, Xu, S, Chai, J, Gu, L. | | Deposit date: | 2011-08-27 | | Release date: | 2012-06-27 | | Last modified: | 2023-11-01 | | Method: | X-RAY DIFFRACTION (2.183 Å) | | Cite: | Structural insights into a unique Legionella pneumophila effector LidA recognizing both GDP and GTP bound Rab1 in their active state
Plos Pathog., 8, 2012
|
|
3TLQ
 | | Crystal structure of EAL-like domain protein YdiV | | Descriptor: | GLYCEROL, PHOSPHATE ION, Regulatory protein YdiV | | Authors: | Li, B, Li, N, Wang, F, Guo, L, Liu, C, Zhu, D, Xu, S, Gu, L. | | Deposit date: | 2011-08-30 | | Release date: | 2012-09-12 | | Last modified: | 2024-03-20 | | Method: | X-RAY DIFFRACTION (1.91 Å) | | Cite: | Structural insight of a concentration-dependent mechanism by which YdiV inhibits Escherichia coli flagellum biogenesis and motility
Nucleic Acids Res., 40, 2012
|
|
5GK9
 | | Crystal structure of human HBO1 in complex with BRPF2 | | Descriptor: | ACETYL COENZYME *A, BRD1 protein, Histone acetyltransferase KAT7, ... | | Authors: | Tao, Y, Zhu, J, Xu, S, Ding, J. | | Deposit date: | 2016-07-04 | | Release date: | 2017-03-29 | | Last modified: | 2023-11-08 | | Method: | X-RAY DIFFRACTION (2.4 Å) | | Cite: | Structural and mechanistic insights into regulation of HBO1 histone acetyltransferase activity by BRPF2.
Nucleic Acids Res., 45, 2017
|
|
3LDY
 | | An extraordinary mechanism of DNA perturbation exhibited by the rare-cutting HNH restriction endonuclease PacI | | Descriptor: | CALCIUM ION, DNA (5'-D(*GP*AP*GP*GP*CP*TP*TP*A)-3'), DNA (5'-D(P*AP*TP*TP*AP*AP*GP*CP*CP*TP*C)-3'), ... | | Authors: | Shen, B.W, Heiter, D, Chan, S.-H, Xu, S.-Y, Wilson, G, Stoddard, B.L. | | Deposit date: | 2010-01-13 | | Release date: | 2010-04-21 | | Last modified: | 2024-02-21 | | Method: | X-RAY DIFFRACTION (1.97 Å) | | Cite: | Unusual target site disruption by the rare-cutting HNH restriction endonuclease PacI.
Structure, 18, 2010
|
|
