4ZCF

Structural basis of asymmetric DNA methylation and ATP-triggered long-range diffusion by EcoP15I

Summary for 4ZCF

Entry DOI	10.2210/pdb4zcf/pdb
Descriptor	Restriction endonuclease EcoP15I, modification subunit, Restriction endonuclease EcoP15I, restriction subunit, DNA 20-mer ATACAGCAGTAGACTATGAT, ... (8 entities in total)
Functional Keywords	hydrolase/dna, atp motor, dna methyltransferase, asymmetric dna methylation, hydrolase-dna complex
Biological source	Escherichia coli More
Total number of polymer chains	5
Total formula weight	272262.26
Authors	Gupta, Y.K.,Chan, S.H.,Xu, S.Y.,Aggarwal, A.K. (deposition date: 2015-04-15, release date: 2015-07-29, Last modification date: 2024-03-06)
Primary citation	Gupta, Y.K.,Chan, S.H.,Xu, S.Y.,Aggarwal, A.K. Structural basis of asymmetric DNA methylation and ATP-triggered long-range diffusion by EcoP15I. Nat Commun, 6:7363-7363, 2015 Cited by PubMed: 26067164 DOI: 10.1038/ncomms8363 PDB entries with the same primary citation
Experimental method	X-RAY DIFFRACTION (2.6 Å)

Structure validation