Loading
PDBj
MenuPDBj@FacebookPDBj@X(formerly Twitter)PDBj@BlueSkyPDBj@YouTubewwPDB FoundationwwPDBDonate
RCSB PDBPDBeBMRBAdv. SearchSearch help

4ZCF

Structural basis of asymmetric DNA methylation and ATP-triggered long-range diffusion by EcoP15I

Summary for 4ZCF
Entry DOI10.2210/pdb4zcf/pdb
DescriptorRestriction endonuclease EcoP15I, modification subunit, Restriction endonuclease EcoP15I, restriction subunit, DNA 20-mer ATACAGCAGTAGACTATGAT, ... (8 entities in total)
Functional Keywordshydrolase/dna, atp motor, dna methyltransferase, asymmetric dna methylation, hydrolase-dna complex
Biological sourceEscherichia coli
More
Total number of polymer chains5
Total formula weight272262.26
Authors
Gupta, Y.K.,Chan, S.H.,Xu, S.Y.,Aggarwal, A.K. (deposition date: 2015-04-15, release date: 2015-07-29, Last modification date: 2024-03-06)
Primary citationGupta, Y.K.,Chan, S.H.,Xu, S.Y.,Aggarwal, A.K.
Structural basis of asymmetric DNA methylation and ATP-triggered long-range diffusion by EcoP15I.
Nat Commun, 6:7363-7363, 2015
Cited by
PubMed Abstract: Type III R-M enzymes were identified >40 years ago and yet there is no structural information on these multisubunit enzymes. Here we report the structure of a Type III R-M system, consisting of the entire EcoP15I complex (Mod2Res1) bound to DNA. The structure suggests how ATP hydrolysis is coupled to long-range diffusion of a helicase on DNA, and how a dimeric methyltransferase functions to methylate only one of the two DNA strands. We show that the EcoP15I motor domains are specifically adapted to bind double-stranded DNA and to facilitate DNA sliding via a novel 'Pin' domain. We also uncover unexpected 'division of labour', where one Mod subunit recognizes DNA, while the other Mod subunit methylates the target adenine--a mechanism that may extend to adenine N6 RNA methylation in mammalian cells. Together the structure sheds new light on the mechanisms of both helicases and methyltransferases in DNA and RNA metabolism.
PubMed: 26067164
DOI: 10.1038/ncomms8363
PDB entries with the same primary citation
Experimental method
X-RAY DIFFRACTION (2.6 Å)
Structure validation

259351

PDB entries from 2026-09-09

PDB statisticsPDBj update infoContact PDBjnumon