4ZCF
Structural basis of asymmetric DNA methylation and ATP-triggered long-range diffusion by EcoP15I
Entity
| Entity ID | Chain ID | Description | Type | Chain length | Formula weight | Number of molecules | DB Name (Accession) | Biological source | Descriptive keywords |
| 1 | A, B (A, B) | Restriction endonuclease EcoP15I, modification subunit | polymer | 644 | 74190.7 | 2 | UniProt (Q5ZND1) Pfam (PF01555) Pfam (PF18273) UniProt (by SIFTS) (P12364) | Escherichia coli | |
| 2 | C (C) | Restriction endonuclease EcoP15I, restriction subunit | polymer | 970 | 111109.6 | 1 | UniProt (Q5ZND2) Pfam (PF04851) Pfam (PF19778) | Escherichia coli | |
| 3 | D (D) | DNA 20-mer ATACAGCAGTAGACTATGAT | polymer | 20 | 6166.0 | 1 | Escherichia coli | ||
| 4 | E (E) | DNA 20-mer AATCATAGTCTACTGCTGTA | polymer | 20 | 6108.0 | 1 | Escherichia coli | ||
| 5 | F, G (A) | MANGANESE (II) ION | non-polymer | 54.9 | 2 | Chemie (MN) | |||
| 6 | H (C) | ADENOSINE MONOPHOSPHATE | non-polymer | 347.2 | 1 | Chemie (AMP) | |||
| 7 | I (D) | CALCIUM ION | non-polymer | 40.1 | 1 | Chemie (CA) | |||
| 8 | J, K, L, M, N (A, B, C, D, E) | water | water | 18.0 | 95 | Chemie (HOH) |
Sequence viewer
Contents of the asymmetric unit
| Polymers | Number of chains | 5 |
| Total formula weight | 271765.1 | |
| Non-Polymers* | Number of molecules | 4 |
| Total formula weight | 497.2 | |
| All* | Total formula weight | 272262.3 |






