4BGH
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 4bgh by Molmil](/molmil-images/mine/4bgh) | Crystal Structure of CDK2 in complex with pan-CDK Inhibitor | Descriptor: | 4-((5-BROMO-4-(PROP-2-YN-1-YLAMINO)PYRIMIDIN-2-YL)AMINO)BENZENESULFONAMIDE, CYCLIN-DEPENDENT KINASE 2 | Authors: | Luecking, U, Jautelat, R, Krueger, M, Brumby, T, Lienau, P, Schaefer, M, Briem, H, Schulze, J, Hillisch, A, Reichel, A, Siemeister, G. | Deposit date: | 2013-03-26 | Release date: | 2013-09-04 | Last modified: | 2024-05-08 | Method: | X-RAY DIFFRACTION (1.95 Å) | Cite: | The Lab Oddity Prevails: Discovery of Pan-Cdk Inhibitor (R)- S-Cyclopropyl-S-(4-{[4-{[(1R,2R)-2-Hydroxy-1-Methylpropyl]Oxy}-5-(Trifluoromethyl)Pyrimidin-2-Yl]Amino}Phenyl)Sulfoximide (Bay 1000394) for the Treatment of Cancer. Chemmedchem, 8, 2013
|
|
4BLP
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 4blp by Molmil](/molmil-images/mine/4blp) | P4 PROTEIN FROM BACTERIOPHAGE PHI13 | Descriptor: | CITRATE ANION, GLYCEROL, PACKAGING ENZYME P4 | Authors: | El Omari, K, Meier, C, Kainov, D, Sutton, G, Grimes, J.M, Poranen, M.M, Bamford, D.H, Tuma, R, Stuart, D.I, Mancini, E.J. | Deposit date: | 2013-05-04 | Release date: | 2013-08-21 | Last modified: | 2024-05-08 | Method: | X-RAY DIFFRACTION (1.7 Å) | Cite: | Tracking in Atomic Detail the Functional Specializations in Viral Reca Helicases that Occur During Evolution. Nucleic Acids Res., 41, 2013
|
|
4CSH
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 4csh by Molmil](/molmil-images/mine/4csh) | Native structure of the lytic CHAPK domain of the endolysin LysK from Staphylococcus aureus bacteriophage K | Descriptor: | 2-(N-MORPHOLINO)-ETHANESULFONIC ACID, CALCIUM ION, GLYCEROL, ... | Authors: | Sanz-Gaitero, M, Keary, R, Garcia-Doval, C, Coffey, A, van Raaij, M.J. | Deposit date: | 2014-03-07 | Release date: | 2014-08-06 | Last modified: | 2023-12-20 | Method: | X-RAY DIFFRACTION (1.79 Å) | Cite: | Crystal structure of the lytic CHAP(K) domain of the endolysin LysK from Staphylococcus aureus bacteriophage K. Virol. J., 11, 2014
|
|
4ARJ
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 4arj by Molmil](/molmil-images/mine/4arj) | Crystal structure of a pesticin (translocation and receptor binding domain) from Y. pestis and T4-lysozyme chimera | Descriptor: | PESTICIN, LYSOZYME, SULFATE ION | Authors: | Zeth, K, Patzer, S.I, Albrecht, R, Braun, V. | Deposit date: | 2012-04-24 | Release date: | 2012-05-09 | Last modified: | 2024-05-08 | Method: | X-RAY DIFFRACTION (2.593 Å) | Cite: | Structure and Mechanistic Studies of Pesticin, a Bacterial Homolog of Phage Lysozymes. J.Biol.Chem., 287, 2012
|
|
4BLO
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 4blo by Molmil](/molmil-images/mine/4blo) | P4 PROTEIN FROM BACTERIOPHAGE PHI6 IN COMPLEX WITH ADP | Descriptor: | ADENOSINE-5'-DIPHOSPHATE, CALCIUM ION, PACKAGING ENZYME P4 | Authors: | El Omari, K, Meier, C, Kainov, D, Sutton, G, Grimes, J.M, Poranen, M.M, Bamford, D.H, Tuma, R, Stuart, D.I, Mancini, E.J. | Deposit date: | 2013-05-04 | Release date: | 2013-08-21 | Last modified: | 2024-05-08 | Method: | X-RAY DIFFRACTION (2.8 Å) | Cite: | Tracking in Atomic Detail the Functional Specializations in Viral Reca Helicases that Occur During Evolution. Nucleic Acids Res., 41, 2013
|
|
4B6L
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 4b6l by Molmil](/molmil-images/mine/4b6l) | Discovery of Oral Polo-Like Kinase (PLK) Inhibitors with Enhanced Selectivity Profile using Residue Targeted Drug Design | Descriptor: | 4-[[(4R)-5-cyclopentyl-4-ethyl-3a,4-dihydro-3H-[1,2,4]triazolo[4,3-f]pteridin-7-yl]amino]-N-cyclopropyl-3-methoxy-benzamide, SERINE/THREONINE-PROTEIN KINASE PLK3, SULFATE ION | Authors: | Brown, K, Charrier, J.D, Durrant, S, Griffiths, M, Hudson, C, Kay, D, Knegtel, R, ODonnell, M, Pierard, F, Twin, H, Weber, P, Young, S. | Deposit date: | 2012-08-14 | Release date: | 2013-08-21 | Last modified: | 2024-05-08 | Method: | X-RAY DIFFRACTION (1.9 Å) | Cite: | Discovery of Oral Polo-Like Kinase (Plk) Inhibitors with Enhanced Selectivity Profile Using Residue Targeted Drug Design To be Published
|
|
6J5D
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 6j5d by Molmil](/molmil-images/mine/6j5d) | Complex structure of MAb 4.2-scFv with louping ill virus envelope protein Domain III | Descriptor: | Envelope, antibody heavy chain, antibody light chain | Authors: | Yang, X, Qi, J, Peng, R, Dai, L, Gould, E.A, Tien, P, Gao, G.F. | Deposit date: | 2019-01-10 | Release date: | 2019-02-06 | Last modified: | 2023-11-22 | Method: | X-RAY DIFFRACTION (1.8 Å) | Cite: | Molecular Basis of a Protective/Neutralizing Monoclonal Antibody Targeting Envelope Proteins of both Tick-Borne Encephalitis Virus and Louping Ill Virus. J. Virol., 93, 2019
|
|
4AT2
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 4at2 by Molmil](/molmil-images/mine/4at2) | The crystal structure of 3-ketosteroid-delta4-(5alpha)-dehydrogenase from Rhodococcus jostii RHA1 in complex with 4-androstene-3,17- dione | Descriptor: | 3-KETOSTEROID-DELTA4-5ALPHA-DEHYDROGENASE, 4-ANDROSTENE-3-17-DIONE, CHLORIDE ION, ... | Authors: | van Oosterwijk, N, Knol, J, Dijkhuizen, L, van der Geize, R, Dijkstra, B.W. | Deposit date: | 2012-05-03 | Release date: | 2012-08-01 | Last modified: | 2024-05-08 | Method: | X-RAY DIFFRACTION (1.6 Å) | Cite: | Structure and Catalytic Mechanism of 3-Ketosteroid-{Delta}4-(5Alpha)-Dehydrogenase from Rhodococcus Jostii Rha1 Genome. J.Biol.Chem., 287, 2012
|
|
4C0Y
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 4c0y by Molmil](/molmil-images/mine/4c0y) | Cryo-EM reconstruction of empty enterovirus 71 in complex with a neutralizing antibody E18 | Descriptor: | FAB EV18 4 D6-1 F1 G9, VP1, VP2, ... | Authors: | Plevka, P, Perera, R, Cardosa, J, Suksatu, A, Kuhn, R.J, Rossmann, M.G. | Deposit date: | 2013-08-08 | Release date: | 2014-02-05 | Last modified: | 2024-05-08 | Method: | ELECTRON MICROSCOPY (16 Å) | Cite: | Neutralizing Antibodies Can Initiate Genome Release from Human Enterovirus 71. Proc.Natl.Acad.Sci.USA, 111, 2014
|
|
4BP7
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 4bp7 by Molmil](/molmil-images/mine/4bp7) | Asymmetric structure of a virus-receptor complex | Descriptor: | COAT PROTEIN | Authors: | Dent, K.C, Thompson, R, Barker, A.M, Barr, J.N, Hiscox, J.A, Stockley, P.G, Ranson, N.A. | Deposit date: | 2013-05-23 | Release date: | 2013-07-17 | Last modified: | 2024-05-08 | Method: | ELECTRON MICROSCOPY (39 Å) | Cite: | The Asymmetric Structure of an Icosahedral Virus Bound its Receptor Suggests a Mechanism for Genome Release. Structure, 21, 2013
|
|
4BQT
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 4bqt by Molmil](/molmil-images/mine/4bqt) | Aplysia californica AChBP in complex with Cytisine | Descriptor: | (1R,5S)-1,2,3,4,5,6-HEXAHYDRO-8H-1,5-METHANOPYRIDO[1,2-A][1,5]DIAZOCIN-8-ONE, CHLORIDE ION, COBALT (II) ION, ... | Authors: | Rucktooa, P, Haseler, C.A, vanElke, R, Smit, A.B, Gallagher, T, Sixma, T.K. | Deposit date: | 2013-06-02 | Release date: | 2013-06-12 | Last modified: | 2023-12-20 | Method: | X-RAY DIFFRACTION (2.88 Å) | Cite: | Structural Characterization of Binding Mode of Smoking Cessation Drugs to Nicotinic Acetylcholine Receptors Through Study of Ligand Complexes with Acetylcholine-Binding Protein. J.Biol.Chem., 287, 2012
|
|
4C55
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 4c55 by Molmil](/molmil-images/mine/4c55) | Crystal structure of serum-derived human IgG4 Fc | Descriptor: | 1,2-ETHANEDIOL, 2-(N-MORPHOLINO)-ETHANESULFONIC ACID, IG GAMMA-4 CHAIN C REGION, ... | Authors: | Davies, A.M, Rispens, T, Ooijevaar-deHeer, P, Gould, H.J, Jefferis, R, Aalberse, R.C, Sutton, B.J. | Deposit date: | 2013-09-10 | Release date: | 2013-11-13 | Last modified: | 2023-12-20 | Method: | X-RAY DIFFRACTION (2.35 Å) | Cite: | Structural Determinants of Unique Properties of Human Igg4-Fc J.Mol.Biol., 426, 2014
|
|
4BY8
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 4by8 by Molmil](/molmil-images/mine/4by8) | |
4BZI
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 4bzi by Molmil](/molmil-images/mine/4bzi) | The structure of the COPII coat assembled on membranes | Descriptor: | MAGNESIUM ION, PHOSPHOAMINOPHOSPHONIC ACID-GUANYLATE ESTER, SAR1P, ... | Authors: | Zanetti, G, Prinz, S, Daum, S, Meister, A, Schekman, R, Bacia, K, Briggs, J.A.G. | Deposit date: | 2013-07-26 | Release date: | 2013-09-18 | Last modified: | 2024-05-08 | Method: | ELECTRON MICROSCOPY (23 Å) | Cite: | The Structure of the Copii Transport-Vesicle Coat Assembled on Membranes Elife, 2, 2013
|
|
1SJP
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 1sjp by Molmil](/molmil-images/mine/1sjp) | |
6LHC
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 6lhc by Molmil](/molmil-images/mine/6lhc) | The cryo-EM structure of coxsackievirus A16 empty particle | Descriptor: | VP1, VP2, VP3 | Authors: | He, M.Z, Xu, L.F, Zheng, Q.B, Zhu, R, Yin, Z.C, Cheng, T, Li, S.W. | Deposit date: | 2019-12-07 | Release date: | 2020-02-05 | Last modified: | 2024-05-29 | Method: | ELECTRON MICROSCOPY (3.43 Å) | Cite: | Identification of Antibodies with Non-overlapping Neutralization Sites that Target Coxsackievirus A16. Cell Host Microbe, 27, 2020
|
|
6LHL
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 6lhl by Molmil](/molmil-images/mine/6lhl) | The cryo-EM structure of coxsackievirus A16 A-particle in complex with Fab 18A7 | Descriptor: | VP1 protein, VP2 protein, VP3 protein | Authors: | He, M.Z, Xu, L.F, Zheng, Q.B, Zhu, R, Yin, Z.C, Cheng, T, Li, S.W. | Deposit date: | 2019-12-09 | Release date: | 2020-02-05 | Last modified: | 2024-05-29 | Method: | ELECTRON MICROSCOPY (3.07 Å) | Cite: | Identification of Antibodies with Non-overlapping Neutralization Sites that Target Coxsackievirus A16. Cell Host Microbe, 27, 2020
|
|
4BV6
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 4bv6 by Molmil](/molmil-images/mine/4bv6) | Refined crystal structure of the human Apoptosis inducing factor | Descriptor: | APOPTOSIS-INDUCING FACTOR 1, MITOCHONDRIAL, FLAVIN-ADENINE DINUCLEOTIDE, ... | Authors: | Martinez-Julvez, M, Herguedas, B, Hermoso, J.A, Ferreira, P, Villanueva, R, Medina, M. | Deposit date: | 2013-06-25 | Release date: | 2014-09-17 | Last modified: | 2024-05-08 | Method: | X-RAY DIFFRACTION (1.8 Å) | Cite: | Structural Insights Into the Coenzyme Mediated Monomer-Dimer Transition of the Pro-Apoptotic Apoptosis Inducing Factor. Biochemistry, 53, 2014
|
|
1SAX
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 1sax by Molmil](/molmil-images/mine/1sax) | Three-dimensional structure of s.aureus methicillin-resistance regulating transcriptional repressor meci in complex with 25-bp ds-DNA | Descriptor: | 5'-d(CAAAATTACAACTGTAATATCGGAG)-3', 5'-d(GCTCCGATATTACAGTTGTAATTTT)-3', Methicillin resistance regulatory protein mecI, ... | Authors: | Garcia-Castellanos, R, Mallorqui-Fernandez, G, Marrero, A, Potempa, J, Coll, M, Gomis-Ruth, F.X. | Deposit date: | 2004-02-09 | Release date: | 2004-04-27 | Last modified: | 2023-08-23 | Method: | X-RAY DIFFRACTION (2.8 Å) | Cite: | On the transcriptional regulation of methicillin resistance: MecI repressor in complex with its operator J.Biol.Chem., 279, 2004
|
|
6LHB
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 6lhb by Molmil](/molmil-images/mine/6lhb) | The cryo-EM structure of coxsackievirus A16 A-particle | Descriptor: | VP1, VP2, VP3 | Authors: | He, M.Z, Xu, L.F, Zheng, Q.B, Zhu, R, Yin, Z.C, Cheng, T, Li, S.W. | Deposit date: | 2019-12-07 | Release date: | 2020-02-05 | Last modified: | 2024-05-29 | Method: | ELECTRON MICROSCOPY (3.33 Å) | Cite: | Identification of Antibodies with Non-overlapping Neutralization Sites that Target Coxsackievirus A16. Cell Host Microbe, 27, 2020
|
|
4BN6
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 4bn6 by Molmil](/molmil-images/mine/4bn6) | |
4BZK
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 4bzk by Molmil](/molmil-images/mine/4bzk) | The structure of the COPII coat assembled on membranes | Descriptor: | Protein transport protein SEC13, Protein transport protein SEC31 | Authors: | Zanetti, G, Prinz, S, Daum, S, Meister, A, Schekman, R, Bacia, K, Briggs, J.A.G. | Deposit date: | 2013-07-26 | Release date: | 2013-09-18 | Last modified: | 2024-05-08 | Method: | ELECTRON MICROSCOPY (40 Å) | Cite: | The Structure of the Copii Transport-Vesicle Coat Assembled on Membranes Elife, 2, 2013
|
|
4C4Q
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 4c4q by Molmil](/molmil-images/mine/4c4q) | Cryo-EM map of the CSFV IRES in complex with the small ribosomal 40S subunit and DHX29 | Descriptor: | INTERNAL RIBOSOMAL ENTRY SITE | Authors: | Hashem, Y, desGeorges, A, Dhote, V, Langlois, R, Liao, H.Y, Grassucci, R.A, Pestova, T.V, Hellen, C.U.T, Frank, J. | Deposit date: | 2013-09-07 | Release date: | 2013-10-30 | Last modified: | 2024-05-08 | Method: | ELECTRON MICROSCOPY (8.5 Å) | Cite: | Hepatitis-C-Virus-Like Internal Ribosome Entry Sites Displace Eif3 to Gain Access to the 40S Subunit Nature, 503, 2013
|
|
4CDL
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 4cdl by Molmil](/molmil-images/mine/4cdl) | Crystal Structure of Retro-aldolase RA110.4-6 Complexed with Inhibitor 1-(6-methoxy-2-naphthalenyl)-1,3-butanedione | Descriptor: | (2E)-1-(6-methoxynaphthalen-2-yl)but-2-en-1-one, STEROID DELTA-ISOMERASE | Authors: | Pinkas, D.M, Studer, S, Obexer, R, Giger, L, Gruetter, M.G, Baker, D, Hilvert, D. | Deposit date: | 2013-11-01 | Release date: | 2014-11-12 | Last modified: | 2023-12-20 | Method: | X-RAY DIFFRACTION (2.5 Å) | Cite: | Active Site Plasticity of a Computationally Designed Retro-Aldolase Enzyme To be Published
|
|
6L16
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 6l16 by Molmil](/molmil-images/mine/6l16) | Crystal structure of Ser/Thr kinase Pim1 in complex with 10-DEBC derivatives | Descriptor: | 2-[4-[2-(7-chloranylpyrido[3,4-b][1,4]benzoxazin-5-yl)ethyl]piperidin-1-yl]ethanamine, Serine/threonine-protein kinase pim-1 | Authors: | Zhang, W, Xie, Y, Cao, R, Huang, N, Zhou, Y. | Deposit date: | 2019-09-27 | Release date: | 2020-05-27 | Last modified: | 2023-11-22 | Method: | X-RAY DIFFRACTION (2.1 Å) | Cite: | Structure-Based Optimization of 10-DEBC Derivatives as Potent and Selective Pim-1 Kinase Inhibitors. J.Chem.Inf.Model., 60, 2020
|
|