6FO0
 
 | | CryoEM structure of bovine cytochrome bc1 in complex with the anti-malarial compound GSK932121 | | Descriptor: | 3-chloro-6-(hydroxymethyl)-2-methyl-5-{4-[3-(trifluoromethoxy)phenoxy]phenyl}pyridin-4-ol, Chain I/V, Cytochrome b, ... | | Authors: | Johnson, R.M, Amporndanai, K, O'Neill, P.M, Fishwick, C.W.G, Jamson, A.H, Rawson, S.D, Hasnain, S.S, Antonyuk, S.V, Muench, S.P. | | Deposit date: | 2018-02-05 | | Release date: | 2018-02-28 | | Last modified: | 2019-12-11 | | Method: | ELECTRON MICROSCOPY (4.1 Å) | | Cite: | X-ray and cryo-EM structures of inhibitor-bound cytochromebc1complexes for structure-based drug discovery.
IUCrJ, 5, 2018
|
|
6FO2
 | | CryoEM structure of bovine cytochrome bc1 with no ligand bound | | Descriptor: | Cytochrome b, Cytochrome b-c1 complex subunit 1, mitochondrial, ... | | Authors: | Johnson, R.M, Amporndanai, K, O'Neill, P.M, Fishwick, C.W.G, Jamson, A.H, Rawson, S.D, Hasnain, S.S, Antonyuk, S.V, Muench, S.P. | | Deposit date: | 2018-02-05 | | Release date: | 2018-02-28 | | Last modified: | 2019-12-11 | | Method: | ELECTRON MICROSCOPY (4.4 Å) | | Cite: | X-ray and cryo-EM structures of inhibitor-bound cytochromebc1complexes for structure-based drug discovery.
IUCrJ, 5, 2018
|
|
6FO6
 | | CryoEM structure of bovine cytochrome bc1 in complex with the anti-malarial inhibitor SCR0911 | | Descriptor: | 7-methoxy-3-methyl-2-[5-[4-(trifluoromethyloxy)phenyl]pyridin-3-yl]quinolin-4-ol, Cytochrome b, Cytochrome b-c1 complex subunit 1, ... | | Authors: | Johnson, R.M, Amporndanai, K, O'Neill, P.M, Fishwick, C.W.G, Jamson, A.H, Rawson, S.D, Hasnain, S.S, Antonyuk, S.V, Muench, S.P. | | Deposit date: | 2018-02-06 | | Release date: | 2018-02-28 | | Last modified: | 2019-12-11 | | Method: | ELECTRON MICROSCOPY (4.1 Å) | | Cite: | X-ray and cryo-EM structures of inhibitor-bound cytochromebc1complexes for structure-based drug discovery.
IUCrJ, 5, 2018
|
|
4TKP
 | | Complex of Ubc13 with the RING domain of the TRIM5alpha retroviral restriction factor | | Descriptor: | SULFATE ION, Tripartite motif-containing protein 5, Ubiquitin-conjugating enzyme E2 N, ... | | Authors: | Johnson, R, Taylor, A.B, Hart, P.J, Ivanov, D.N. | | Deposit date: | 2014-05-27 | | Release date: | 2015-07-22 | | Last modified: | 2023-12-27 | | Method: | X-RAY DIFFRACTION (2.08 Å) | | Cite: | RING Dimerization Links Higher-Order Assembly of TRIM5 alpha to Synthesis of K63-Linked Polyubiquitin.
Cell Rep, 12, 2015
|
|
7RTB
 | | Peptide-19 bound to the Glucagon-Like Peptide-1 Receptor (GLP-1R) | | Descriptor: | Glucagon-like peptide 1 receptor, Guanine nucleotide-binding protein G(I)/G(S)/G(O) subunit gamma-2, Guanine nucleotide-binding protein G(I)/G(S)/G(T) subunit beta-1, ... | | Authors: | Johnson, R.M, Danev, R, Sexton, P.M, Wootten, D. | | Deposit date: | 2021-08-12 | | Release date: | 2021-10-06 | | Method: | ELECTRON MICROSCOPY (2.14 Å) | | Cite: | Cryo-EM structure of the dual incretin receptor agonist, peptide-19, in complex with the glucagon-like peptide-1 receptor.
Biochem.Biophys.Res.Commun., 578, 2021
|
|
1W08
 | | STRUCTURE OF T70N HUMAN LYSOZYME | | Descriptor: | CHLORIDE ION, LYSOZYME | | Authors: | Johnson, R, Christodoulou, J, Luisi, B, Dumoulin, M, Caddy, G, Alcocer, M, Murtagh, G, Archer, D.B, Dobson, C.M. | | Deposit date: | 2004-06-02 | | Release date: | 2004-06-10 | | Last modified: | 2023-12-13 | | Method: | X-RAY DIFFRACTION (2.5 Å) | | Cite: | Rationalising Lysozyme Amyloidosis: Insights from the Structure and Solution Dynamics of T70N Lysozyme.
J.Mol.Biol., 352, 2005
|
|
5E3M
 | | Crystal structure of Fis bound to 27bp DNA F35 (AAATTAGTTTGAATCTCGAGCTAATTT) | | Descriptor: | DNA (27-MER), DNA-binding protein Fis | | Authors: | Stella, S, Hancock, S.P, Cascio, D, Johnson, R.C. | | Deposit date: | 2015-10-03 | | Release date: | 2016-03-09 | | Last modified: | 2024-05-22 | | Method: | X-RAY DIFFRACTION (2.886 Å) | | Cite: | DNA Sequence Determinants Controlling Affinity, Stability and Shape of DNA Complexes Bound by the Nucleoid Protein Fis.
Plos One, 11, 2016
|
|
1LX8
 | | Regulation of directionality in bacteriophage lambda site-specific recombination: structure of the Xis protein | | Descriptor: | Excisionase | | Authors: | Sam, M.D, Papagiannis, C, Connolly, K.M, Corselli, L, Iwahara, J, Lee, J, Phillips, M, Wojciak, J.M, Johnson, R.C, Clubb, R.T. | | Deposit date: | 2002-06-04 | | Release date: | 2003-06-10 | | Last modified: | 2024-05-22 | | Method: | SOLUTION NMR | | Cite: | Regulation of directionality in bacteriophage lambda site-specific recombination: structure of the Xis protein
J.Mol.Biol., 324, 2002
|
|
1LWA
 | | Solution Structure of SRY_DNA | | Descriptor: | 5'-D(*CP*TP*GP*AP*AP*CP*AP*AP*TP*CP*AP*CP*CP*CP*C)-3', 5'-D(*GP*GP*GP*GP*TP*GP*AP*TP*TP*GP*TP*TP*CP*AP*G)-3' | | Authors: | Masse, J.E, Wong, B, Yen, Y.-M, Allain, F.H.-T, Johnson, R.C, Feigon, J. | | Deposit date: | 2002-05-30 | | Release date: | 2002-10-16 | | Last modified: | 2024-05-22 | | Method: | SOLUTION NMR | | Cite: | The S. cerevisiae architectural HMGB protein NHP6A complexed with DNA: DNA and protein conformational changes upon binding
J.Mol.Biol., 323, 2002
|
|
6DGC
 | | Crystal structure of the C-terminal catalytic domain of ISC1926 TnpA, an IS607-like serine recombinase | | Descriptor: | ISC1926 TnpA C-terminal catalytic domain | | Authors: | Hancock, S.P, Kumar, P, Cascio, D, Johnson, R.C. | | Deposit date: | 2018-05-17 | | Release date: | 2018-07-18 | | Last modified: | 2023-10-11 | | Method: | X-RAY DIFFRACTION (2.92 Å) | | Cite: | Multiple serine transposase dimers assemble the transposon-end synaptic complex during IS607-family transposition.
Elife, 7, 2018
|
|
6RQZ
 | | GOLGI ALPHA-MANNOSIDASE II complex with Manno-epi-cyclophellitol aziridine | | Descriptor: | (1~{R},2~{S},3~{R},4~{R},5~{S},6~{R})-5-azanyl-6-(hydroxymethyl)cyclohexane-1,2,3,4-tetrol, 1,2-ETHANEDIOL, Alpha-mannosidase 2, ... | | Authors: | Armstrong, Z, Lahav, D, Johnson, R, Kuo, C.L, Beenakker, T.J.M, de Boer, C, Wong, C.S, Debets, M, van der Stelt, M, Codee, J.D.C, Aerts, J.M.F.G, Wu, L, Overkleeft, H.S, Davies, G.J. | | Deposit date: | 2019-05-16 | | Release date: | 2020-07-08 | | Last modified: | 2024-01-24 | | Method: | X-RAY DIFFRACTION (1.53 Å) | | Cite: | Manno- epi -cyclophellitols Enable Activity-Based Protein Profiling of Human alpha-Mannosidases and Discovery of New Golgi Mannosidase II Inhibitors.
J.Am.Chem.Soc., 142, 2020
|
|
6RRW
 | | GOLGI ALPHA-MANNOSIDASE II in complex with (2R,3R,4R,5S)-1-(5-{[4-(3,4-Dihydro-2H-1,5-benzodioxepin-7-yl)benzyl]oxy}pentyl)-2-(hydroxymethyl)-3,4,5-piperidinetriol | | Descriptor: | (2~{R},3~{R},4~{R},5~{S})-1-[5-[[4-(3,4-dihydro-2~{H}-1,5-benzodioxepin-7-yl)phenyl]methoxy]pentyl]-2-(hydroxymethyl)piperidine-3,4,5-triol, Alpha-mannosidase 2, ZINC ION | | Authors: | Armstrong, Z, Lahav, D, Johnson, R, Kuo, C.L, Beenakker, T.J.M, de Boer, C, Wong, C.S, van Rijssel, E.R, Debets, M, Geurink, P.P, Ovaa, H, van der Stelt, M, Codee, J.D.C, Aerts, J.M.F.G, Wu, L, Overkleeft, H.S, Davies, G.J. | | Deposit date: | 2019-05-20 | | Release date: | 2020-07-08 | | Last modified: | 2024-01-24 | | Method: | X-RAY DIFFRACTION (2.15 Å) | | Cite: | Manno- epi -cyclophellitols Enable Activity-Based Protein Profiling of Human alpha-Mannosidases and Discovery of New Golgi Mannosidase II Inhibitors.
J.Am.Chem.Soc., 142, 2020
|
|
6RRN
 | | GOLGI ALPHA-MANNOSIDASE II in complex with pentyl 2,5-dideoxy-2,5-imino-D-talo-hexonamide | | Descriptor: | (2~{S},3~{R},4~{S},5~{R})-5-(hydroxymethyl)-3,4-bis(oxidanyl)-~{N}-pentyl-pyrrolidine-2-carboxamide, 1,2-ETHANEDIOL, Alpha-mannosidase 2, ... | | Authors: | Armstrong, Z, Lahav, D, Johnson, R, Kuo, C.L, Beenakker, T.J.M, de Boer, C, Wong, C.S, van Rijssel, E.R, Debets, M, Geurink, P.P, Ovaa, H, van der Stelt, M, Codee, J.D.C, Aerts, J.M.F.G, Wu, L, Overkleeft, H.S, Davies, G.J. | | Deposit date: | 2019-05-20 | | Release date: | 2020-07-08 | | Last modified: | 2024-01-24 | | Method: | X-RAY DIFFRACTION (1.59 Å) | | Cite: | Manno- epi -cyclophellitols Enable Activity-Based Protein Profiling of Human alpha-Mannosidases and Discovery of New Golgi Mannosidase II Inhibitors.
J.Am.Chem.Soc., 142, 2020
|
|
6RRJ
 | | GOLGI ALPHA-MANNOSIDASE II in complex with 5-(Adamantan-1yl-methoxy)-pentyl 2,5-dideoxy-2,5-imino-D-talo-hexonamide | | Descriptor: | (2~{S},3~{R},4~{S},5~{R})-~{N}-[5-(1-adamantylmethoxy)pentyl]-5-(hydroxymethyl)-3,4-bis(oxidanyl)pyrrolidine-2-carboxamide, 1,2-ETHANEDIOL, Alpha-mannosidase 2, ... | | Authors: | Armstrong, Z, Lahav, D, Johnson, R, Kuo, C.L, Beenakker, T.J.M, de Boer, C, Wong, C.S, van Rijssel, E.R, Debets, M, Geurink, P.P, Ovaa, H, van der Stelt, M, Codee, J.D.C, Aerts, J.M.F.G, Wu, L, Overkleeft, H.S, Davies, G.J. | | Deposit date: | 2019-05-20 | | Release date: | 2020-07-08 | | Last modified: | 2024-10-09 | | Method: | X-RAY DIFFRACTION (1.95 Å) | | Cite: | Manno- epi -cyclophellitols Enable Activity-Based Protein Profiling of Human alpha-Mannosidases and Discovery of New Golgi Mannosidase II Inhibitors.
J.Am.Chem.Soc., 142, 2020
|
|
6RRU
 | | GOLGI ALPHA-MANNOSIDASE II in complex with (5R,6R,7S,8S)-5,6,7,8-tetrahydro-5-(hydroxymethyl)-3-(3-phenylpropyl)imidazo[1,2-a]pyridine-6,7,8-triol | | Descriptor: | (5~{R},6~{R},7~{S},8~{S})-5-(hydroxymethyl)-2-(3-phenylpropyl)-5,6,7,8-tetrahydroimidazo[1,2-a]pyridine-6,7,8-triol, Alpha-mannosidase 2, ZINC ION | | Authors: | Armstrong, Z, Lahav, D, Johnson, R, Kuo, C.L, Beenakker, T.J.M, de Boer, C, Wong, C.S, van Rijssel, E.R, Debets, M, Geurink, P.P, Ovaa, H, van der Stelt, M, Codee, J.D.C, Aerts, J.M.F.G, Wu, L, Overkleeft, H.S, Davies, G.J. | | Deposit date: | 2019-05-20 | | Release date: | 2020-07-08 | | Last modified: | 2024-01-24 | | Method: | X-RAY DIFFRACTION (1.9 Å) | | Cite: | Manno- epi -cyclophellitols Enable Activity-Based Protein Profiling of Human alpha-Mannosidases and Discovery of New Golgi Mannosidase II Inhibitors.
J.Am.Chem.Soc., 142, 2020
|
|
6RRH
 | | GOLGI ALPHA-MANNOSIDASE II | | Descriptor: | 1,2-ETHANEDIOL, Alpha-mannosidase 2, ZINC ION | | Authors: | Armstrong, Z, Lahav, D, Johnson, R, Kuo, C.L, Beenakker, T.J.M, de Boer, C, Wong, C.S, van Rijssel, E.R, Debets, M, Geurink, P.P, Ovaa, H, van der Stelt, M, Codee, J.D.C, Aerts, J.M.F.G, Wu, L, Overkleeft, H.S, Davies, G.J. | | Deposit date: | 2019-05-18 | | Release date: | 2020-07-08 | | Last modified: | 2024-01-24 | | Method: | X-RAY DIFFRACTION (2.07 Å) | | Cite: | Manno- epi -cyclophellitols Enable Activity-Based Protein Profiling of Human alpha-Mannosidases and Discovery of New Golgi Mannosidase II Inhibitors.
J.Am.Chem.Soc., 142, 2020
|
|
6RPC
 | | GOLGI ALPHA-MANNOSIDASE II | | Descriptor: | 1,2-ETHANEDIOL, Alpha-mannosidase 2, SUCCINIC ACID, ... | | Authors: | Armstrong, Z, Lahav, D, Johnson, R, Kuo, C.L, Beenakker, T.J.M, de Boer, C, Wong, C.S, Debets, M, van der Stelt, M, Codee, J.D.C, Aerts, J.M.F.G, Wu, L, Overkleeft, H.S, Davies, G.J. | | Deposit date: | 2019-05-14 | | Release date: | 2020-07-08 | | Last modified: | 2024-01-24 | | Method: | X-RAY DIFFRACTION (1.69 Å) | | Cite: | Manno- epi -cyclophellitols Enable Activity-Based Protein Profiling of Human alpha-Mannosidases and Discovery of New Golgi Mannosidase II Inhibitors.
J.Am.Chem.Soc., 142, 2020
|
|
6RRY
 | | GOLGI ALPHA-MANNOSIDASE II in complex with (2S,3R)-2-(Hydroxymethyl)-1,2,3,6-tetrahydro-3-pyridinol | | Descriptor: | (2~{S},3~{R})-2-(hydroxymethyl)-1,2,3,6-tetrahydropyridin-3-ol, 1,2-ETHANEDIOL, Alpha-mannosidase 2, ... | | Authors: | Armstrong, Z, Lahav, D, Johnson, R, Kuo, C.L, Beenakker, T.J.M, de Boer, C, Wong, C.S, van Rijssel, E.R, Debets, M, Geurink, P.P, Ovaa, H, van der Stelt, M, Codee, J.D.C, Aerts, J.M.F.G, Wu, L, Overkleeft, H.S, Davies, G.J. | | Deposit date: | 2019-05-20 | | Release date: | 2020-07-08 | | Last modified: | 2024-01-24 | | Method: | X-RAY DIFFRACTION (1.86 Å) | | Cite: | Manno- epi -cyclophellitols Enable Activity-Based Protein Profiling of Human alpha-Mannosidases and Discovery of New Golgi Mannosidase II Inhibitors.
J.Am.Chem.Soc., 142, 2020
|
|
6RS0
 | | GOLGI ALPHA-MANNOSIDASE II in complex with (2S,3S,4R,5R)-1-(2-(Benzyloxy)ethyl)-2-(hydroxymethyl)piperidine-3,4,5-triol | | Descriptor: | (2~{S},3~{S},4~{R})-2-(hydroxymethyl)-1-(2-phenylmethoxyethyl)piperidine-3,4,5-triol, 1,2-ETHANEDIOL, Alpha-mannosidase 2, ... | | Authors: | Armstrong, Z, Lahav, D, Johnson, R, Kuo, C.L, Beenakker, T.J.M, de Boer, C, Wong, C.S, van Rijssel, E.R, Debets, M, Geurink, P.P, Ovaa, H, van der Stelt, M, Codee, J.D.C, Aerts, J.M.F.G, Wu, L, Overkleeft, H.S, Davies, G.J. | | Deposit date: | 2019-05-20 | | Release date: | 2020-07-08 | | Last modified: | 2024-01-24 | | Method: | X-RAY DIFFRACTION (1.8 Å) | | Cite: | Manno- epi -cyclophellitols Enable Activity-Based Protein Profiling of Human alpha-Mannosidases and Discovery of New Golgi Mannosidase II Inhibitors.
J.Am.Chem.Soc., 142, 2020
|
|
6RRX
 | | GOLGI ALPHA-MANNOSIDASE II in complex with (2S,3R)-2-(Hydroxymethyl)-3-piperidinol | | Descriptor: | (2~{S},3~{R})-2-(hydroxymethyl)piperidin-3-ol, 1,2-ETHANEDIOL, Alpha-mannosidase 2, ... | | Authors: | Armstrong, Z, Lahav, D, Johnson, R, Kuo, C.L, Beenakker, T.J.M, de Boer, C, Wong, C.S, van Rijssel, E.R, Debets, M, Geurink, P.P, Ovaa, H, van der Stelt, M, Codee, J.D.C, Aerts, J.M.F.G, Wu, L, Overkleeft, H.S, Davies, G.J. | | Deposit date: | 2019-05-20 | | Release date: | 2020-07-08 | | Last modified: | 2024-01-24 | | Method: | X-RAY DIFFRACTION (1.84 Å) | | Cite: | Manno- epi -cyclophellitols Enable Activity-Based Protein Profiling of Human alpha-Mannosidases and Discovery of New Golgi Mannosidase II Inhibitors.
J.Am.Chem.Soc., 142, 2020
|
|
7TTU
 | | 50S ribosomal subunit from Staphylococcus aureus (Strain ATCC43300) | | Descriptor: | 23S rRNA, 50S ribosomal protein L13, 50S ribosomal protein L14, ... | | Authors: | Belousoff, M.J, Piper, S, Johnson, R. | | Deposit date: | 2022-02-01 | | Release date: | 2022-07-06 | | Last modified: | 2022-09-14 | | Method: | ELECTRON MICROSCOPY (3 Å) | | Cite: | A Structurally Characterized Staphylococcus aureus Evolutionary Escape Route from Treatment with the Antibiotic Linezolid.
Microbiol Spectr, 10, 2022
|
|
7TTW
 | | 50S ribosomal subunit from Staphylococcus aureus containing double mutation in uL3 imparting linezolid resistance | | Descriptor: | 23S rRNA, 50S ribosomal protein L13, 50S ribosomal protein L14, ... | | Authors: | Belousoff, M.J, Piper, S, Johnson, R. | | Deposit date: | 2022-02-02 | | Release date: | 2022-07-06 | | Last modified: | 2022-09-14 | | Method: | ELECTRON MICROSCOPY (2.9 Å) | | Cite: | A Structurally Characterized Staphylococcus aureus Evolutionary Escape Route from Treatment with the Antibiotic Linezolid.
Microbiol Spectr, 10, 2022
|
|
6WYM
 | |
6WYN
 | |
3MFI
 | | DNA Polymerase Eta in Complex With a cis-syn Thymidine Dimer | | Descriptor: | 2'-DEOXYADENOSINE 5'-TRIPHOSPHATE, 5'-D(*GP*TP*CP*CP*TP*CP*CP*CP*CP*TP*(DOC))-3', 5'-D(*TP*AP*AP*(TTD)P*GP*AP*GP*GP*GP*GP*AP*GP*GP*AP*C)-3', ... | | Authors: | Silverstein, T.D, Johnson, R.E, Jain, R, Prakash, L, Prakash, S, Aggarwal, A.K. | | Deposit date: | 2010-04-02 | | Release date: | 2010-06-23 | | Last modified: | 2023-09-06 | | Method: | X-RAY DIFFRACTION (1.76 Å) | | Cite: | Structural basis for the suppression of skin cancers by DNA polymerase eta.
Nature, 465, 2010
|
|
