1RDR
| POLIOVIRUS 3D POLYMERASE | Descriptor: | CALCIUM ION, POLIOVIRUS 3D POLYMERASE | Authors: | Hansen, J, Long, A, Schultz, S. | Deposit date: | 1998-04-28 | Release date: | 1998-09-16 | Last modified: | 2024-02-14 | Method: | X-RAY DIFFRACTION (2.4 Å) | Cite: | Structure of the RNA-dependent RNA polymerase of poliovirus. Structure, 5, 1997
|
|
1K73
| Co-crystal Structure of Anisomycin Bound to the 50S Ribosomal Subunit | Descriptor: | 23S RRNA, 5S RRNA, ANISOMYCIN, ... | Authors: | Hansen, J, Ban, N, Nissen, P, Moore, P.B, Steitz, T.A. | Deposit date: | 2001-10-18 | Release date: | 2003-07-22 | Last modified: | 2023-08-16 | Method: | X-RAY DIFFRACTION (3.01 Å) | Cite: | Structures of Five Antibiotics Bound at the Peptidyl Transferase Center of
the Large Ribosomal Subunit J.Mol.Biol., 330, 2003
|
|
2HXY
| Crystal structure of human apo-eIF4AIII | Descriptor: | Probable ATP-dependent RNA helicase DDX48 | Authors: | Johansen, J.S, Andersen, G.R. | Deposit date: | 2006-08-04 | Release date: | 2006-08-15 | Last modified: | 2024-02-14 | Method: | X-RAY DIFFRACTION (3.3 Å) | Cite: | Structure of the exon junction core complex with a trapped DEAD-box ATPase bound to RNA. Science, 313, 2006
|
|
4DTE
| |
6EZE
| The open conformation of E.coli Elongation Factor Tu in complex with GDPNP. | Descriptor: | DI(HYDROXYETHYL)ETHER, Elongation factor Tu 2, GLYCEROL, ... | Authors: | Johansen, J.S, Blaise, M, Thirup, S.S. | Deposit date: | 2017-11-15 | Release date: | 2018-08-22 | Last modified: | 2024-01-17 | Method: | X-RAY DIFFRACTION (2.47 Å) | Cite: | E. coli elongation factor Tu bound to a GTP analogue displays an open conformation equivalent to the GDP-bound form. Nucleic Acids Res., 46, 2018
|
|
4KDS
| |
8BIK
| Crystal structure of human AMPK heterotrimer in complex with allosteric activator C455 | Descriptor: | (3~{R},3~{a}~{R},6~{R},6~{a}~{R})-6-[[6-chloranyl-5-[4-[4-[[dimethyl(oxidanyl)-$l^{4}-sulfanyl]amino]phenyl]phenyl]-3~{H}-imidazo[4,5-b]pyridin-2-yl]oxy]-2,3,3~{a},5,6,6~{a}-hexahydrofuro[3,2-b]furan-3-ol, 5'-AMP-activated protein kinase catalytic subunit alpha-2, 5'-AMP-activated protein kinase subunit beta-1, ... | Authors: | Schimpl, M, Mather, K.M, Boland, M.L, Rivers, E.L, Srivastava, A, Hemsley, P, Robinson, J, Wan, P.T, Hansen, J, Read, J.A, Trevaskis, J.L, Smith, D.M. | Deposit date: | 2022-11-02 | Release date: | 2024-05-15 | Last modified: | 2024-06-12 | Method: | X-RAY DIFFRACTION (2.5 Å) | Cite: | Direct beta 1/ beta 2 AMPK activation reduces liver steatosis but not fibrosis in a mouse model of non-alcoholic steatohepatitis Biorxiv, 2024
|
|
8P2W
| Structure of human SIT1 (focussed map / refinement) | Descriptor: | 2-acetamido-2-deoxy-beta-D-glucopyranose, Processed angiotensin-converting enzyme 2, Sodium- and chloride-dependent transporter XTRP3 | Authors: | Li, H.Z, Pike, A.C.W, Chi, G, Hansen, J.S, Lee, S.G, Rodstrom, K.E.J, Bushell, S.R, Speedman, D, Evans, A, Wang, D, He, D, Shrestha, L, Nasrallah, C, Chalk, R, Moreira, T, MacLean, E.M, Marsden, B, Bountra, C, Burgess-Brown, N.A, Dafforn, T.R, Carpenter, E.P, Sauer, D.B. | Deposit date: | 2023-05-16 | Release date: | 2024-06-12 | Last modified: | 2024-07-10 | Method: | ELECTRON MICROSCOPY (3.76 Å) | Cite: | Structure and function of the SIT1 proline transporter in complex with the COVID-19 receptor ACE2. Nat Commun, 15, 2024
|
|
8P2Z
| Structure of human SIT1 bound to L-pipecolate (focussed map / refinement) | Descriptor: | (2S)-piperidine-2-carboxylic acid, 2-acetamido-2-deoxy-beta-D-glucopyranose, CHLORIDE ION, ... | Authors: | Li, H.Z, Pike, A.C.W, Chi, G, Hansen, J.S, Lee, S.G, Rodstrom, K.E.J, Bushell, S.R, Speedman, D, Evans, A, Wang, D, He, D, Shrestha, L, Nasrallah, C, Chalk, R, Moreira, T, MacLean, E.M, Marsden, B, Bountra, C, Burgess-Brown, N.A, Dafforn, T.R, Carpenter, E.P, Sauer, D.B. | Deposit date: | 2023-05-16 | Release date: | 2024-06-12 | Last modified: | 2024-07-10 | Method: | ELECTRON MICROSCOPY (3.5 Å) | Cite: | Structure and function of the SIT1 proline transporter in complex with the COVID-19 receptor ACE2. Nat Commun, 15, 2024
|
|
8P30
| Structure of human SIT1:ACE2 complex (open PD conformation) bound to L-pipecolate | Descriptor: | (2S)-piperidine-2-carboxylic acid, 2-acetamido-2-deoxy-alpha-D-glucopyranose, 2-acetamido-2-deoxy-beta-D-glucopyranose, ... | Authors: | Li, H.Z, Pike, A.C.W, Chi, G, Hansen, J.S, Lee, S.G, Rodstrom, K.E.J, Bushell, S.R, Speedman, D, Evans, A, Wang, D, He, D, Shrestha, L, Nasrallah, C, Chalk, R, Moreira, T, MacLean, E.M, Marsden, B, Bountra, C, Burgess-Brown, N.A, Dafforn, T.R, Carpenter, E.P, Sauer, D.B. | Deposit date: | 2023-05-16 | Release date: | 2024-06-12 | Last modified: | 2024-07-10 | Method: | ELECTRON MICROSCOPY (3.29 Å) | Cite: | Structure and function of the SIT1 proline transporter in complex with the COVID-19 receptor ACE2. Nat Commun, 15, 2024
|
|
8P2Y
| Structure of human SIT1:ACE2 complex (closed PD conformation) | Descriptor: | 2-acetamido-2-deoxy-alpha-D-glucopyranose, 2-acetamido-2-deoxy-beta-D-glucopyranose, 2-acetamido-2-deoxy-beta-D-glucopyranose-(1-4)-2-acetamido-2-deoxy-beta-D-glucopyranose, ... | Authors: | Li, H.Z, Pike, A.C.W, Chi, G, Hansen, J.S, Lee, S.G, Rodstrom, K.E.J, Bushell, S.R, Speedman, D, Evans, A, Wang, D, He, D, Shrestha, L, Nasrallah, C, Chalk, R, Moreira, T, MacLean, E.M, Marsden, B, Bountra, C, Burgess-Brown, N.A, Dafforn, T.R, Carpenter, E.P, Sauer, D.B. | Deposit date: | 2023-05-16 | Release date: | 2024-06-12 | Last modified: | 2024-07-10 | Method: | ELECTRON MICROSCOPY (3.46 Å) | Cite: | Structure and function of the SIT1 proline transporter in complex with the COVID-19 receptor ACE2. Nat Commun, 15, 2024
|
|
8P31
| Structure of human SIT1:ACE2 complex (closed PD conformation) bound to L-pipecolate | Descriptor: | (2S)-piperidine-2-carboxylic acid, 2-acetamido-2-deoxy-alpha-D-glucopyranose, 2-acetamido-2-deoxy-beta-D-glucopyranose, ... | Authors: | Li, H.Z, Pike, A.C.W, Chi, G, Hansen, J.S, Lee, S.G, Rodstrom, K.E.J, Bushell, S.R, Speedman, D, Evans, A, Wang, D, He, D, Shrestha, L, Nasrallah, C, Chalk, R, Moreira, T, MacLean, E.M, Marsden, B, Bountra, C, Burgess-Brown, N.A, Dafforn, T.R, Carpenter, E.P, Sauer, D.B. | Deposit date: | 2023-05-16 | Release date: | 2024-06-12 | Last modified: | 2024-07-10 | Method: | ELECTRON MICROSCOPY (3.24 Å) | Cite: | Structure and function of the SIT1 proline transporter in complex with the COVID-19 receptor ACE2. Nat Commun, 15, 2024
|
|
8P2X
| Structure of human SIT1:ACE2 complex (open PD conformation) | Descriptor: | 2-acetamido-2-deoxy-alpha-D-glucopyranose, 2-acetamido-2-deoxy-beta-D-glucopyranose, 2-acetamido-2-deoxy-beta-D-glucopyranose-(1-4)-2-acetamido-2-deoxy-beta-D-glucopyranose, ... | Authors: | Li, H.Z, Pike, A.C.W, Chi, G, Hansen, J.S, Lee, S.G, Rodstrom, K.E.J, Bushell, S.R, Speedman, D, Evans, A, Wang, D, He, D, Shrestha, L, Nasrallah, C, Chalk, R, Moreira, T, MacLean, E.M, Marsden, B, Bountra, C, Burgess-Brown, N.A, Dafforn, T.R, Carpenter, E.P, Sauer, D.B. | Deposit date: | 2023-05-16 | Release date: | 2024-06-12 | Last modified: | 2024-07-10 | Method: | ELECTRON MICROSCOPY (3.59 Å) | Cite: | Structure and function of the SIT1 proline transporter in complex with the COVID-19 receptor ACE2. Nat Commun, 15, 2024
|
|
1FFK
| CRYSTAL STRUCTURE OF THE LARGE RIBOSOMAL SUBUNIT FROM HALOARCULA MARISMORTUI AT 2.4 ANGSTROM RESOLUTION | Descriptor: | 23S RRNA, 5S RRNA, CADMIUM ION, ... | Authors: | Ban, N, Nissen, P, Hansen, J, Moore, P.B, Steitz, T.A. | Deposit date: | 2000-07-25 | Release date: | 2000-08-14 | Last modified: | 2024-02-07 | Method: | X-RAY DIFFRACTION (2.4 Å) | Cite: | The complete atomic structure of the large ribosomal subunit at 2.4 A resolution. Science, 289, 2000
|
|
1FFZ
| LARGE RIBOSOMAL SUBUNIT COMPLEXED WITH R(CC)-DA-PUROMYCIN | Descriptor: | 23S RIBOSOMAL RNA, R(P*CP*C*)-D(P*A)-R(P*(PU)) | Authors: | Nissen, P, Hansen, J, Ban, N, Moore, P.B, Steitz, T.A. | Deposit date: | 2000-07-26 | Release date: | 2000-08-28 | Last modified: | 2024-02-07 | Method: | X-RAY DIFFRACTION (3.2 Å) | Cite: | The structural basis of ribosome activity in peptide bond synthesis. Science, 289, 2000
|
|
1FG0
| LARGE RIBOSOMAL SUBUNIT COMPLEXED WITH A 13 BP MINIHELIX-PUROMYCIN COMPOUND | Descriptor: | 23S RIBOSOMAL RNA, 5'-R(CCGGCGGGCUGGUUCAAACCGGCCCGCCGGACC)-3'-5'-R(P-PUROMYCIN)-3' | Authors: | Nissen, P, Hansen, J, Ban, N, Moore, P.B, Steitz, T.A. | Deposit date: | 2000-07-26 | Release date: | 2000-08-28 | Last modified: | 2024-02-07 | Method: | X-RAY DIFFRACTION (3 Å) | Cite: | The structural basis of ribosome activity in peptide bond synthesis. Science, 289, 2000
|
|
3C1B
| The effect of H3 K79 dimethylation and H4 K20 trimethylation on nucleosome and chromatin structure | Descriptor: | Histone 2, H2bf, Histone H2A type 1, ... | Authors: | Lu, X, Simon, M, Chodaparambil, J, Hansen, J, Shokat, K, Luger, K. | Deposit date: | 2008-01-22 | Release date: | 2008-10-07 | Last modified: | 2023-11-15 | Method: | X-RAY DIFFRACTION (2.2 Å) | Cite: | The effect of H3K79 dimethylation and H4K20 trimethylation on nucleosome and chromatin structure. Nat.Struct.Mol.Biol., 15, 2008
|
|
3C1C
| The effect of H3 K79 dimethylation and H4 K20 trimethylation on nucleosome and chromatin structure | Descriptor: | Histone 2, H2bf, Histone H2A type 1, ... | Authors: | Lu, X, Simon, M, Chodaparambil, J, Hansen, J, Shokat, K, Luger, K. | Deposit date: | 2008-01-22 | Release date: | 2008-10-07 | Last modified: | 2023-11-15 | Method: | X-RAY DIFFRACTION (3.15 Å) | Cite: | The effect of H3K79 dimethylation and H4K20 trimethylation on nucleosome and chromatin structure. Nat.Struct.Mol.Biol., 15, 2008
|
|
1YX7
| NMR structure of Calsensin, energy minimized average structure. | Descriptor: | Calsensin | Authors: | Venkitaramani, D.V, Fulton, D.B, Andreotti, A.H, Johansen, K.M, Johansen, J. | Deposit date: | 2005-02-19 | Release date: | 2005-04-01 | Last modified: | 2024-05-22 | Method: | SOLUTION NMR | Cite: | Solution structure and backbone dynamics of Calsensin, an invertebrate neuronal calcium-binding protein. Protein Sci., 14, 2005
|
|
1YX8
| NMR structure of Calsensin, 20 low energy structures. | Descriptor: | Calsensin | Authors: | Venkitaramani, D.V, Fulton, D.B, Andreotti, A.H, Johansen, K.M, Johansen, J. | Deposit date: | 2005-02-19 | Release date: | 2005-04-05 | Last modified: | 2024-05-22 | Method: | SOLUTION NMR | Cite: | Solution structure and backbone dynamics of Calsensin, an invertebrate neuronal calcium-binding protein. Protein Sci., 14, 2005
|
|