7NSG
 
 | | Structure of human excitatory amino acid transporter 3 (EAAT3) in complex with HIP-B | | Descriptor: | (+)-3-Hydroxy-4,5,6,6a-tetrahydro-3aH-pyrrolo[3,4-d]isoxazole-6-carboxylic acid, (-)-3-Hydroxy-4,5,6,6a-tetrahydro-3aH-pyrrolo[3,4-d]isoxazole-6-carboxylic acid, 1,2-DIACYL-SN-GLYCERO-3-PHOSPHOCHOLINE, ... | | Authors: | Baronina, A, Pike, A.C.W, Yu, X, Dong, Y.Y, Shintre, C.A, Tessitore, A, Chu, A, Rotty, B, Venkaya, S, Mukhopadhyay, S.M.M, Borkowska, O, Chalk, R, Shrestha, L, Burgess-Brown, N.A, Edwards, A.M, Arrowsmith, C.H, Bountra, C, Han, S, Carpenter, E.P, Structural Genomics Consortium (SGC) | | Deposit date: | 2021-03-05 | | Release date: | 2022-03-16 | | Last modified: | 2024-07-10 | | Method: | ELECTRON MICROSCOPY (3.34 Å) | | Cite: | Structure of human excitatory amino acid transporter 3 (EAAT3) in complex with HIP-B
TO BE PUBLISHED
|
|
4ZCF
 | | Structural basis of asymmetric DNA methylation and ATP-triggered long-range diffusion by EcoP15I | | Descriptor: | ADENOSINE MONOPHOSPHATE, CALCIUM ION, DNA 20-mer AATCATAGTCTACTGCTGTA, ... | | Authors: | Gupta, Y.K, Chan, S.H, Xu, S.Y, Aggarwal, A.K. | | Deposit date: | 2015-04-15 | | Release date: | 2015-07-29 | | Last modified: | 2024-03-06 | | Method: | X-RAY DIFFRACTION (2.6 Å) | | Cite: | Structural basis of asymmetric DNA methylation and ATP-triggered long-range diffusion by EcoP15I.
Nat Commun, 6, 2015
|
|
4ZKT
 | |
4ZJM
 | | Crystal Structure of Mycobacterium tuberculosis LpqH (Rv3763) | | Descriptor: | CHLORIDE ION, GLYCEROL, Lipoprotein LpqH, ... | | Authors: | Arbing, M.A, Chan, S, Kuo, E, Harris, L.R, Zhou, T.T, Eisenberg, D, TB Structural Genomics Consortium (TBSGC) | | Deposit date: | 2015-04-29 | | Release date: | 2015-05-13 | | Last modified: | 2023-09-27 | | Method: | X-RAY DIFFRACTION (2.851 Å) | | Cite: | Crystal Structure of Mycobacterium tuberculosis LpqH (Rv3763)
To Be Published
|
|
6LYY
 | | Cryo-EM structure of the human MCT1/Basigin-2 complex in the presence of anti-cancer drug candidate AZD3965 in the outward-open conformation. | | Descriptor: | 3-methyl-5-[[(4~{R})-4-methyl-4-oxidanyl-1,2-oxazolidin-2-yl]carbonyl]-6-[[5-methyl-3-(trifluoromethyl)-1~{H}-pyrazol-4-yl]methyl]-1-propan-2-yl-thieno[2,3-d]pyrimidine-2,4-dione, Basigin, Monocarboxylate transporter 1 | | Authors: | Wang, N, Jiang, X, Zhang, S, Zhu, A, Yuan, Y, Lei, J, Yan, C. | | Deposit date: | 2020-02-16 | | Release date: | 2020-12-23 | | Last modified: | 2024-03-27 | | Method: | ELECTRON MICROSCOPY (3.2 Å) | | Cite: | Structural basis of human monocarboxylate transporter 1 inhibition by anti-cancer drug candidates.
Cell, 184, 2021
|
|
3FIE
 | |
4NEC
 | | Conversion of a Disulfide Bond into a Thioacetal Group during Echinomycin Biosynthesis | | Descriptor: | 2-CARBOXYQUINOXALINE, ACETATE ION, Echinomycin, ... | | Authors: | Hotta, K, Keegan, R.M, Ranganathan, S, Fang, M, Bibby, J, Winn, M.D, Sato, M, Lian, M, Watanabe, K, Rigden, D.J, Kim, C.-Y. | | Deposit date: | 2013-10-29 | | Release date: | 2014-01-15 | | Last modified: | 2024-04-03 | | Method: | X-RAY DIFFRACTION (1.5 Å) | | Cite: | Conversion of a disulfide bond into a thioacetal group during echinomycin biosynthesis.
Angew.Chem.Int.Ed.Engl., 53, 2014
|
|
4NJT
 | | Crystal structure of multidrug-resistant clinical isolate A02 HIV-1 protease in complex with darunavir | | Descriptor: | (3R,3AS,6AR)-HEXAHYDROFURO[2,3-B]FURAN-3-YL(1S,2R)-3-[[(4-AMINOPHENYL)SULFONYL](ISOBUTYL)AMINO]-1-BENZYL-2-HYDROXYPROPYLCARBAMATE, Protease | | Authors: | Yedidi, R.S, Garimella, H, Chang, S.B, Kaufman, J.D, Das, D, Wingfield, P.T, Ghosh, A.K, Mitsuya, H. | | Deposit date: | 2013-11-11 | | Release date: | 2014-04-02 | | Last modified: | 2024-02-28 | | Method: | X-RAY DIFFRACTION (1.95 Å) | | Cite: | A Conserved Hydrogen-Bonding Network of P2 bis-Tetrahydrofuran-Containing HIV-1 Protease Inhibitors (PIs) with a Protease Active-Site Amino Acid Backbone Aids in Their Activity against PI-Resistant HIV.
Antimicrob.Agents Chemother., 58, 2014
|
|
4NJV
 | | Crystal structure of multidrug-resistant clinical isolate A02 HIV-1 protease in complex with ritonavir | | Descriptor: | Protease, RITONAVIR | | Authors: | Yedidi, R.S, Garimella, H, Chang, S.B, Kaufman, J.D, Das, D, Wingfield, P.T, Mitsuya, H. | | Deposit date: | 2013-11-11 | | Release date: | 2014-04-02 | | Last modified: | 2024-02-28 | | Method: | X-RAY DIFFRACTION (1.8 Å) | | Cite: | A Conserved Hydrogen-Bonding Network of P2 bis-Tetrahydrofuran-Containing HIV-1 Protease Inhibitors (PIs) with a Protease Active-Site Amino Acid Backbone Aids in Their Activity against PI-Resistant HIV.
Antimicrob.Agents Chemother., 58, 2014
|
|
6B5V
 | | Structure of TRPV5 in complex with econazole | | Descriptor: | 1-[(2R)-2-[(4-chlorobenzyl)oxy]-2-(2,4-dichlorophenyl)ethyl]-1H-imidazole, CALCIUM ION, Transient receptor potential cation channel subfamily V member 5 | | Authors: | Hughes, T.E.T, Lodowski, D.T, Huynh, K.W, Yazici, A, del Rosario, J, Kapoor, A, Basak, S, Samanta, A, Chakrapani, S, Zhou, Z.H, Filizola, M, Rohacs, T, Han, S, Moiseenkova-Bell, V.Y. | | Deposit date: | 2017-09-29 | | Release date: | 2017-12-27 | | Last modified: | 2024-03-13 | | Method: | ELECTRON MICROSCOPY (4.8 Å) | | Cite: | Structural basis of TRPV5 channel inhibition by econazole revealed by cryo-EM.
Nat. Struct. Mol. Biol., 25, 2018
|
|
4ZJX
 | |
4ZW1
 | | Crystal structure of hBRD4 in complex with BL-BI06 reveals a novel synthesized inhibitor that induces Beclin1-independent/ATG5-dependent autophagic cell death in breast cancer | | Descriptor: | 1,2-ETHANEDIOL, 2-(4-hydroxy-3,5-dimethylphenyl)-7-methyl-5,6,7,8-tetrahydropyrido[4',3':4,5]thieno[2,3-d]pyrimidin-4(3H)-one, Bromodomain-containing protein 4 | | Authors: | Liu, B, Zhang, S, Guo, M, Tian, M. | | Deposit date: | 2015-05-19 | | Release date: | 2016-06-22 | | Last modified: | 2024-03-20 | | Method: | X-RAY DIFFRACTION (1.75 Å) | | Cite: | Crystal structure of hBRD4 in complex with BL-BI06 reveals a novel synthesized inhibitor that induces Beclin1-independent/ATG5-dependent autophagic cell death in breast cancer
To Be Published
|
|
7S15
 | | GLP-1 receptor bound with Pfizer small molecule agonist | | Descriptor: | 2-[(4-{6-[(2,4-difluorophenyl)methoxy]pyridin-2-yl}piperidin-1-yl)methyl]-1-[(1-ethyl-1H-imidazol-5-yl)methyl]-1H-benzimidazole-6-carboxylic acid, Glucagon-like peptide 1 receptor | | Authors: | Liu, Y, Dias, J.M, Han, S. | | Deposit date: | 2021-09-01 | | Release date: | 2022-06-08 | | Last modified: | 2022-07-06 | | Method: | ELECTRON MICROSCOPY (3.8 Å) | | Cite: | A Small-Molecule Oral Agonist of the Human Glucagon-like Peptide-1 Receptor.
J.Med.Chem., 65, 2022
|
|
3TUC
 | | Crystal structure of SYK kinase domain with 1-benzyl-N-(5-(6,7-dimethoxyquinolin-4-yloxy)pyridin-2-yl)-2-oxo-1,2-dihydropyridine-3-carboxamide | | Descriptor: | 1-benzyl-N-{5-[(6,7-dimethoxyquinolin-4-yl)oxy]pyridin-2-yl}-2-oxo-1,2-dihydropyridine-3-carboxamide, Tyrosine-protein kinase SYK | | Authors: | Lovering, F, McDonald, J, Whitlock, G, Glossop, P, Phillips, C, Sabnis, Y, Ryan, M, Fitz, L, Lee, J, Chang, J.S, Han, S, Kurumbail, R, Thorarenson, A. | | Deposit date: | 2011-09-16 | | Release date: | 2012-08-29 | | Last modified: | 2024-02-28 | | Method: | X-RAY DIFFRACTION (2.1 Å) | | Cite: | Identification of Type-II Inhibitors Using Kinase Structures.
Chem.Biol.Drug Des., 80, 2012
|
|
4WPZ
 | | Crystal structure of cytochrome P450 CYP107W1 from Streptomyces avermitilis | | Descriptor: | Cytochrome P450, POTASSIUM ION, PROTOPORPHYRIN IX CONTAINING FE | | Authors: | Kang, L.W, Kim, D.H, Pham, T.V, Han, S.H. | | Deposit date: | 2014-10-21 | | Release date: | 2015-04-22 | | Last modified: | 2015-04-29 | | Method: | X-RAY DIFFRACTION (2.1 Å) | | Cite: | Functional characterization of CYP107W1 from Streptomyces avermitilis and biosynthesis of macrolide oligomycin A.
Arch.Biochem.Biophys., 575, 2015
|
|
6USF
 | | CryoEM structure of human alpha4beta2 nicotinic acetylcholine receptor with varenicline in complex with anti-BRIL synthetic antibody BAK5 | | Descriptor: | 2-acetamido-2-deoxy-beta-D-glucopyranose, 2-acetamido-2-deoxy-beta-D-glucopyranose-(1-4)-2-acetamido-2-deoxy-beta-D-glucopyranose, Fab heavy chain, ... | | Authors: | Alvarez, F.J.D, Mukherjee, S, Han, S, Ammirati, M, Kossiakoff, A.A. | | Deposit date: | 2019-10-26 | | Release date: | 2020-04-29 | | Last modified: | 2020-07-29 | | Method: | ELECTRON MICROSCOPY (3.87 Å) | | Cite: | Synthetic antibodies against BRIL as universal fiducial marks for single-particle cryoEM structure determination of membrane proteins.
Nat Commun, 11, 2020
|
|
3TUD
 | | Crystal structure of SYK kinase domain with N-(4-methyl-3-(8-methyl-7-oxo-2-(phenylamino)-7,8-dihydropyrido[2,3-d]pyrimidin-6-yl)phenyl)-3-(trifluoromethyl)benzamide | | Descriptor: | N-{4-methyl-3-[8-methyl-7-oxo-2-(phenylamino)-7,8-dihydropyrido[2,3-d]pyrimidin-6-yl]phenyl}-3-(trifluoromethyl)benzamide, Tyrosine-protein kinase SYK | | Authors: | Lovering, F, McDonald, J, Whitlock, G, Glossop, P, Phillips, C, Sabnis, Y, Ryan, M, Fitz, L, Lee, J, Chang, J.S, Han, S, Kurumbail, R, Thorarenson, A. | | Deposit date: | 2011-09-16 | | Release date: | 2012-08-29 | | Last modified: | 2024-02-28 | | Method: | X-RAY DIFFRACTION (2.33 Å) | | Cite: | Identification of Type-II Inhibitors Using Kinase Structures.
Chem.Biol.Drug Des., 80, 2012
|
|
6WWZ
 | | Cryo-EM structure of the human chemokine receptor CCR6 in complex with CCL20 and a Go protein | | Descriptor: | C-C chemokine receptor type 6,C-C chemokine receptor type 6, C-C motif chemokine 20, Guanine nucleotide-binding protein G(I)/G(S)/G(O) subunit gamma-2, ... | | Authors: | Wasilko, D.J, Johnson, Z.L, Ammirati, M, Han, S, Wu, H. | | Deposit date: | 2020-05-09 | | Release date: | 2020-06-24 | | Last modified: | 2020-07-01 | | Method: | ELECTRON MICROSCOPY (3.34 Å) | | Cite: | Structural basis for chemokine receptor CCR6 activation by the endogenous protein ligand CCL20.
Nat Commun, 11, 2020
|
|
6UR8
 | | CryoEM structure of human alpha4beta2 nicotinic acetylcholine receptor in complex with varenicline | | Descriptor: | 2-acetamido-2-deoxy-beta-D-glucopyranose, Chimera of soluble cytochrome b562 (BRIL) and neuronal acetylcholine receptor subunit alpha-4, Neuronal acetylcholine receptor subunit beta-2, ... | | Authors: | Alvarez, F.J.D, Mukherjee, S, Han, S, Ammirati, M, Kossiakoff, A.A. | | Deposit date: | 2019-10-22 | | Release date: | 2020-04-29 | | Last modified: | 2020-07-29 | | Method: | ELECTRON MICROSCOPY (3.71 Å) | | Cite: | Synthetic antibodies against BRIL as universal fiducial marks for single-particle cryoEM structure determination of membrane proteins.
Nat Commun, 11, 2020
|
|
4E3R
 | | PLP-bound aminotransferase mutant crystal structure from Vibrio fluvialis | | Descriptor: | Pyruvate transaminase, SODIUM ION, SULFATE ION | | Authors: | Midelfort, K.S, Kumar, R, Han, S, Karmilowicz, M.J, McConnell, K, Gehlhaar, D.K, Mistry, A, Chang, J.S, Anderson, M, Vilalobos, A, Minshull, J, Govindarajan, S, Wong, J.W. | | Deposit date: | 2012-03-10 | | Release date: | 2012-10-10 | | Last modified: | 2024-03-06 | | Method: | X-RAY DIFFRACTION (1.9 Å) | | Cite: | Redesigning and characterizing the substrate specificity and activity of Vibrio fluvialis aminotransferase for the synthesis of imagabalin.
Protein Eng.Des.Sel., 26, 2013
|
|
4E3Q
 | | PMP-bound form of Aminotransferase crystal structure from Vibrio fluvialis | | Descriptor: | 4'-DEOXY-4'-AMINOPYRIDOXAL-5'-PHOSPHATE, BENZAMIDINE, Pyruvate transaminase, ... | | Authors: | Midelfort, K.S, Kumar, R, Han, S, Karmilowicz, M.J, McConnell, K, Gehlhaar, D.K, Mistry, A, Chang, J.S, Anderson, M, Vilalobos, A, Minshull, J, Govindarajan, S, Wong, J.W. | | Deposit date: | 2012-03-10 | | Release date: | 2012-10-10 | | Last modified: | 2013-01-02 | | Method: | X-RAY DIFFRACTION (1.9 Å) | | Cite: | Redesigning and characterizing the substrate specificity and activity of Vibrio fluvialis aminotransferase for the synthesis of imagabalin.
Protein Eng.Des.Sel., 26, 2013
|
|
4WQ0
 | |
5CWE
 | | Structure of CYP107L2 from Streptomyces avermitilis with lauric acid | | Descriptor: | Cytochrome P450 hydroxylase, GLYCEROL, LAURIC ACID, ... | | Authors: | Pham, T.-V, Han, S.-H, Kim, J.-H, Kim, D.-H, Kang, L.-W. | | Deposit date: | 2015-07-28 | | Release date: | 2016-08-03 | | Last modified: | 2023-11-08 | | Method: | X-RAY DIFFRACTION (2.39 Å) | | Cite: | Structure of CYP107L2 from Streptomyces avermitilis with lauric acid
To Be Published
|
|
9B1R
 | | Functional implication of the homotrimeric multidomain vacuolar sorting receptor 1 from Arabidopsis thaliana | | Descriptor: | 2-acetamido-2-deoxy-beta-D-glucopyranose-(1-4)-2-acetamido-2-deoxy-beta-D-glucopyranose, Vacuolar-sorting receptor 1 | | Authors: | Park, H, Youn, B, Park, D.J, Puthanveettil, S.V, Kang, C. | | Deposit date: | 2024-03-13 | | Release date: | 2024-05-15 | | Method: | X-RAY DIFFRACTION (3.5 Å) | | Cite: | Functional implication of the homotrimeric multidomain vacuolar sorting receptor 1 (VSR1) from Arabidopsis thaliana.
Sci Rep, 14, 2024
|
|
3T2N
 | | Human hepsin protease in complex with the Fab fragment of an inhibitory antibody | | Descriptor: | Antibody, Fab fragment, Heavy Chain, ... | | Authors: | Koschubs, T, Dengl, S, Duerr, H, Kaluza, K, Georges, G, Hartl, C, Jennewein, S, Lanzendoerfer, M, Auer, J, Stern, A, Huang, K.-S, Kostrewa, D, Ries, S, Hansen, S, Kohnert, U, Cramer, P, Mundigl, O. | | Deposit date: | 2011-07-22 | | Release date: | 2011-12-28 | | Last modified: | 2012-07-25 | | Method: | X-RAY DIFFRACTION (2.55 Å) | | Cite: | Allosteric antibody inhibition of human hepsin protease.
Biochem.J., 442, 2012
|
|
