1FFK
 
 | | CRYSTAL STRUCTURE OF THE LARGE RIBOSOMAL SUBUNIT FROM HALOARCULA MARISMORTUI AT 2.4 ANGSTROM RESOLUTION | | Descriptor: | 23S RRNA, 5S RRNA, CADMIUM ION, ... | | Authors: | Ban, N, Nissen, P, Hansen, J, Moore, P.B, Steitz, T.A. | | Deposit date: | 2000-07-25 | | Release date: | 2000-08-14 | | Last modified: | 2024-02-07 | | Method: | X-RAY DIFFRACTION (2.4 Å) | | Cite: | The complete atomic structure of the large ribosomal subunit at 2.4 A resolution.
Science, 289, 2000
|
|
1AIF
 | | ANTI-IDIOTYPIC FAB 409.5.3 (IGG2A) FAB FROM MOUSE | | Descriptor: | ANTI-IDIOTYPIC FAB 409.5.3 (IGG2A) FAB (HEAVY CHAIN), ANTI-IDIOTYPIC FAB 409.5.3 (IGG2A) FAB (LIGHT CHAIN) | | Authors: | Ban, N, Escobar, C, Hasel, K, Day, J, Greenwood, A, McPherson, A. | | Deposit date: | 1994-11-14 | | Release date: | 1997-02-01 | | Last modified: | 2024-10-30 | | Method: | X-RAY DIFFRACTION (2.9 Å) | | Cite: | Structure of an anti-idiotypic Fab against feline peritonitis virus-neutralizing antibody and a comparison with the complexed Fab.
FASEB J., 9, 1995
|
|
1IAI
 | | IDIOTYPE-ANTI-IDIOTYPE FAB COMPLEX | | Descriptor: | ANTI-IDIOTYPIC FAB 409.5.3 (IGG2A), IDIOTYPIC FAB 730.1.4 (IGG1) OF VIRUS NEUTRALIZING ANTIBODY | | Authors: | Ban, N, Escobar, C, Garcia, R, Hasel, K, Day, J, Greenwood, A, McPherson, A. | | Deposit date: | 1993-12-28 | | Release date: | 1996-03-08 | | Last modified: | 2024-10-16 | | Method: | X-RAY DIFFRACTION (2.9 Å) | | Cite: | Crystal structure of an idiotype-anti-idiotype Fab complex.
Proc.Natl.Acad.Sci.USA, 91, 1994
|
|
1C04
 | | IDENTIFICATION OF KNOWN PROTEIN AND RNA STRUCTURES IN A 5 A MAP OF THE LARGE RIBOSOMAL SUBUNIT FROM HALOARCULA MARISMORTUI | | Descriptor: | 23S RRNA FRAGMENT, RIBOSOMAL PROTEIN L11, RIBOSOMAL PROTEIN L14, ... | | Authors: | Ban, N, Nissen, P, Capel, M, Moore, P.B, Steitz, T.A. | | Deposit date: | 1999-07-14 | | Release date: | 1999-08-31 | | Last modified: | 2024-10-30 | | Method: | X-RAY DIFFRACTION (5 Å) | | Cite: | Placement of protein and RNA structures into a 5 A-resolution map of the 50S ribosomal subunit.
Nature, 400, 1999
|
|
1STM
 | | SATELLITE PANICUM MOSAIC VIRUS | | Descriptor: | SATELLITE PANICUM MOSAIC VIRUS | | Authors: | Ban, N, McPherson, A. | | Deposit date: | 1995-07-12 | | Release date: | 1997-01-27 | | Last modified: | 2024-02-14 | | Method: | X-RAY DIFFRACTION (1.9 Å) | | Cite: | The structure of satellite panicum mosaic virus at 1.9 A resolution.
Nat.Struct.Biol., 2, 1995
|
|
1GHF
 | | ANTI-ANTI-IDIOTYPE GH1002 FAB FRAGMENT | | Descriptor: | ANTI-ANTI-IDIOTYPE GH1002 FAB FRAGMENT | | Authors: | Ban, N, Day, J, Wang, X, Ferrone, S, McPherson, A. | | Deposit date: | 1995-11-30 | | Release date: | 1996-12-23 | | Last modified: | 2024-11-13 | | Method: | X-RAY DIFFRACTION (2.7 Å) | | Cite: | Crystal structure of an anti-anti-idiotype shows it to be self-complementary.
J.Mol.Biol., 255, 1996
|
|
7ELJ
 | |
2LU6
 | | NMR solution structure of Midi peptide designed based on m-conotoxins | | Descriptor: | Midi peptide designed based on m-conotoxins | | Authors: | Dyubankova, N, Lescrinier, E, Stevens, M, Tytgat, J, Herdewijn, P, Peigneur, S. | | Deposit date: | 2012-06-08 | | Release date: | 2012-06-27 | | Last modified: | 2024-11-06 | | Method: | SOLUTION NMR | | Cite: | Design of bioactive peptides from naturally occurring mu-conotoxin structures.
J.Biol.Chem., 287, 2012
|
|
2MN0
 | | D loop of tRNA(Met) | | Descriptor: | 5'-R(*GP*GP*AP*GP*AP*GP*(H2U)P*GP*GP*AP*AP*CP*UP*CP*C)-3' | | Authors: | Lescrinier, E, Dyubankova, N, Herdewijn, P. | | Deposit date: | 2014-03-25 | | Release date: | 2015-04-15 | | Last modified: | 2024-05-15 | | Method: | SOLUTION NMR | | Cite: | Contribution of dihydrouridine in folding of the D-arm in tRNA.
Org.Biomol.Chem., 13, 2015
|
|
2LER
 | | Conotoxin pc16a | | Descriptor: | Conotoxin pc16a | | Authors: | Dyubankova, N, Lescrinier, E, Van Der Haegen, A, Peigneur, S, Tytgat, J. | | Deposit date: | 2011-06-22 | | Release date: | 2012-04-11 | | Last modified: | 2024-11-27 | | Method: | SOLUTION NMR | | Cite: | Pc16a, the first characterized peptide from Conus pictus venom, shows a novel disulfide connectivity.
Peptides, 34, 2012
|
|
7QWR
 | | Structure of the ribosome-nascent chain containing an ER signal sequence in complex with NAC | | Descriptor: | 28S rRNA, 5.8S ribosomal RNA, 5S ribosomal RNA, ... | | Authors: | Jomaa, A, Gamerdinger, M, Hsieh, H, Wallisch, A, Chandrasekaran, V, Ulusoy, Z, Scaiola, A, Hegde, R, Shan, S, Ban, N, Deuerling, E. | | Deposit date: | 2022-01-25 | | Release date: | 2022-03-09 | | Last modified: | 2024-07-17 | | Method: | ELECTRON MICROSCOPY (2.9 Å) | | Cite: | Mechanism of signal sequence handover from NAC to SRP on ribosomes during ER-protein targeting.
Science, 375, 2022
|
|
7QWS
 | | Structure of ribosome translating beta-tubulin in complex with TTC5 and NAC | | Descriptor: | 28S rRNA, 5.8S rRNA, 5S rRNA, ... | | Authors: | Jomaa, A, Gamerdinger, M, Hsieh, H, Wallisch, A, Chandrasekaran, V, Ulusoy, Z, Scaiola, A, Hegde, R, Shan, S, Ban, N, Deuerling, E. | | Deposit date: | 2022-01-25 | | Release date: | 2022-03-09 | | Last modified: | 2024-07-17 | | Method: | ELECTRON MICROSCOPY (3.4 Å) | | Cite: | Mechanism of signal sequence handover from NAC to SRP on ribosomes during ER-protein targeting.
Science, 375, 2022
|
|
7QWQ
 | | Ternary complex of ribosome nascent chain with SRP and NAC | | Descriptor: | 28S rRNA, 5.8S ribosomal RNA, 5S ribosomal RNA, ... | | Authors: | Jomaa, A, Gamerdinger, M, Hsieh, H, Wallisch, A, Chandrasekaran, V, Ulusoy, Z, Scaiola, A, Hegde, R, Shan, S, Ban, N, Deuerling, E. | | Deposit date: | 2022-01-25 | | Release date: | 2022-03-16 | | Last modified: | 2024-07-17 | | Method: | ELECTRON MICROSCOPY (2.83 Å) | | Cite: | Mechanism of signal sequence handover from NAC to SRP on ribosomes during ER-protein targeting.
Science, 375, 2022
|
|
6SJ9
 | | Proteasome accessory factor B/C (PafBC) of Arthrobacter aurescens | | Descriptor: | DI(HYDROXYETHYL)ETHER, POTASSIUM ION, Proteasome accessory factor B/C (PafBC), ... | | Authors: | Mueller, A.U, Leibundgut, M, Ban, N, Weber-Ban, E. | | Deposit date: | 2019-08-13 | | Release date: | 2019-10-16 | | Last modified: | 2024-10-09 | | Method: | X-RAY DIFFRACTION (2.2 Å) | | Cite: | Structure and functional implications of WYL domain-containing bacterial DNA damage response regulator PafBC.
Nat Commun, 10, 2019
|
|
8PPL
 | | MERS-CoV Nsp1 bound to the human 43S pre-initiation complex | | Descriptor: | 18S rRNA, 40S ribosomal protein S10, 40S ribosomal protein S11, ... | | Authors: | Schubert, K, Karousis, E.D, Ban, I, Lapointe, C.P, Leibundgut, M, Baeumlin, E, Kummerant, E, Scaiola, A, Schoenhut, T, Ziegelmueller, J, Puglisi, J.D, Muehlemann, O, Ban, N. | | Deposit date: | 2023-07-07 | | Release date: | 2023-10-18 | | Last modified: | 2024-04-24 | | Method: | ELECTRON MICROSCOPY (2.65 Å) | | Cite: | Universal features of Nsp1-mediated translational shutdown by coronaviruses.
Mol.Cell, 83, 2023
|
|
8PPK
 | | Bat-Hp-CoV Nsp1 and eIF1 bound to the human 40S small ribosomal subunit | | Descriptor: | 18S rRNA, 40S ribosomal protein S10, 40S ribosomal protein S11, ... | | Authors: | Schubert, K, Karousis, E.D, Ban, I, Lapointe, C.P, Leibundgut, M, Baeumlin, E, Kummerant, E, Scaiola, A, Schoenhut, T, Ziegelmueller, J, Puglisi, J.D, Muehlemann, O, Ban, N. | | Deposit date: | 2023-07-07 | | Release date: | 2023-10-18 | | Last modified: | 2024-04-24 | | Method: | ELECTRON MICROSCOPY (2.98 Å) | | Cite: | Universal features of Nsp1-mediated translational shutdown by coronaviruses.
Mol.Cell, 83, 2023
|
|
5LFQ
 | | Crystal Structure of the Bacterial Proteasome Activator Bpa of Mycobacterium tuberculosis (space group P3) | | Descriptor: | Bacterial proteasome activator | | Authors: | Bolten, M, Delley, C.L, Leibundgut, M, Boehringer, D, Ban, N, Weber-Ban, E. | | Deposit date: | 2016-07-04 | | Release date: | 2016-11-23 | | Last modified: | 2024-11-20 | | Method: | X-RAY DIFFRACTION (3.503 Å) | | Cite: | Structural Analysis of the Bacterial Proteasome Activator Bpa in Complex with the 20S Proteasome.
Structure, 24, 2016
|
|
5LFJ
 | | Crystal Structure of the Bacterial Proteasome Activator Bpa of Mycobacterium tuberculosis | | Descriptor: | Bacterial proteasome activator | | Authors: | Bolten, M, Delley, C.L, Leibundgut, M, Boehringer, D, Ban, N, Weber-Ban, E. | | Deposit date: | 2016-07-01 | | Release date: | 2016-11-23 | | Last modified: | 2024-01-10 | | Method: | X-RAY DIFFRACTION (2.6 Å) | | Cite: | Structural Analysis of the Bacterial Proteasome Activator Bpa in Complex with the 20S Proteasome.
Structure, 24, 2016
|
|
5LZP
 | | Binding of the C-terminal GQYL motif of the bacterial proteasome activator Bpa to the 20S proteasome | | Descriptor: | Bacterial proteasome activator, Proteasome subunit alpha, Proteasome subunit beta | | Authors: | Bolten, M, Delley, C.L, Leibundgut, M, Boehringer, D, Ban, N, Weber-Ban, E. | | Deposit date: | 2016-09-30 | | Release date: | 2016-11-23 | | Last modified: | 2024-05-15 | | Method: | ELECTRON MICROSCOPY (3.5 Å) | | Cite: | Structural Analysis of the Bacterial Proteasome Activator Bpa in Complex with the 20S Proteasome.
Structure, 24, 2016
|
|
5LRT
 | | Structure of the Deamidase-Depupylase Dop of the Prokaryotic Ubiquitin-like Modification Pathway in Complex with ADP and Phosphate | | Descriptor: | ADENOSINE-5'-DIPHOSPHATE, DI(HYDROXYETHYL)ETHER, Depupylase, ... | | Authors: | Bolten, M, Vahlensieck, C, Lipp, C, Leibundgut, M, Ban, N, Weber-Ban, E. | | Deposit date: | 2016-08-19 | | Release date: | 2017-02-01 | | Last modified: | 2024-01-17 | | Method: | X-RAY DIFFRACTION (1.85 Å) | | Cite: | Depupylase Dop Requires Inorganic Phosphate in the Active Site for Catalysis.
J. Biol. Chem., 292, 2017
|
|
5LFP
 | | Crystal Structure of the Bacterial Proteasome Activator Bpa of Mycobacterium tuberculosis (space group P6322, SeMet) | | Descriptor: | Bacterial proteasome activator | | Authors: | Bolten, M, Delley, C.L, Leibundgut, M, Boehringer, D, Ban, N, Weber-Ban, E. | | Deposit date: | 2016-07-04 | | Release date: | 2016-11-23 | | Last modified: | 2024-11-06 | | Method: | X-RAY DIFFRACTION (3.303 Å) | | Cite: | Structural Analysis of the Bacterial Proteasome Activator Bpa in Complex with the 20S Proteasome.
Structure, 24, 2016
|
|
1K8A
 | | Co-crystal structure of Carbomycin A bound to the 50S ribosomal subunit of Haloarcula marismortui | | Descriptor: | 23S RRNA, 5S RRNA, CADMIUM ION, ... | | Authors: | Hansen, J.L, Ippolito, J.A, Ban, N, Nissen, P, Moore, P.B, Steitz, T. | | Deposit date: | 2001-10-23 | | Release date: | 2002-07-19 | | Last modified: | 2023-08-16 | | Method: | X-RAY DIFFRACTION (3 Å) | | Cite: | The structures of four macrolide antibiotics bound to the large ribosomal subunit.
Mol.Cell, 10, 2002
|
|
4V19
 | | Structure of the large subunit of the mammalian mitoribosome, part 1 of 2 | | Descriptor: | MAGNESIUM ION, MITORIBOSOMAL 16S RRNA, MITORIBOSOMAL CP TRNA, ... | | Authors: | Greber, B.J, Boehringer, D, Leibundgut, M, Bieri, P, Leitner, A, Schmitz, N, Aebersold, R, Ban, N. | | Deposit date: | 2014-09-25 | | Release date: | 2014-10-08 | | Last modified: | 2024-05-08 | | Method: | ELECTRON MICROSCOPY (3.4 Å) | | Cite: | The Complete Structure of the Large Subunit of the Mammalian Mitochondrial Ribosome
Nature, 515, 2014
|
|
3J8C
 | | Model of the human eIF3 PCI-MPN octamer docked into the 43S EM map | | Descriptor: | Eukaryotic translation initiation factor 3 subunit A, Eukaryotic translation initiation factor 3 subunit C, Eukaryotic translation initiation factor 3 subunit E, ... | | Authors: | Erzberger, J.P, Ban, N. | | Deposit date: | 2014-10-08 | | Release date: | 2014-10-22 | | Last modified: | 2024-02-21 | | Method: | ELECTRON MICROSCOPY (11.6 Å) | | Cite: | Molecular Architecture of the 40SeIF1eIF3 Translation Initiation Complex.
Cell(Cambridge,Mass.), 158, 2014
|
|
1FG0
 | | LARGE RIBOSOMAL SUBUNIT COMPLEXED WITH A 13 BP MINIHELIX-PUROMYCIN COMPOUND | | Descriptor: | 23S RIBOSOMAL RNA, 5'-R(CCGGCGGGCUGGUUCAAACCGGCCCGCCGGACC)-3'-5'-R(P-PUROMYCIN)-3' | | Authors: | Nissen, P, Hansen, J, Ban, N, Moore, P.B, Steitz, T.A. | | Deposit date: | 2000-07-26 | | Release date: | 2000-08-28 | | Last modified: | 2024-02-07 | | Method: | X-RAY DIFFRACTION (3 Å) | | Cite: | The structural basis of ribosome activity in peptide bond synthesis.
Science, 289, 2000
|
|
