2FLL
 
 | | Ternary complex of human DNA polymerase iota with DNA and dTTP | | Descriptor: | DNA polymerase iota, DNA primer strand, DNA template strand, ... | | Authors: | Nair, D.T, Johnson, R.E, Prakash, L, Prakash, S, Aggarwal, A.K. | | Deposit date: | 2006-01-06 | | Release date: | 2006-12-12 | | Last modified: | 2023-08-30 | | Method: | X-RAY DIFFRACTION (2.6 Å) | | Cite: | An incoming nucleotide imposes an anti to syn conformational change on the templating purine in the human DNA polymerase-iota active site.
Structure, 14, 2006
|
|
7JKL
 | |
7JK1
 | |
7JLG
 | |
7JKP
 | |
7JL8
 | |
7JTO
 | | Crystal structure of Protac MS33 in complex with the WD repeat-containing protein 5 and pVHL:ElonginC:ElonginB | | Descriptor: | 1,2-ETHANEDIOL, 3-methyl-N-(11-{[2-(4-{[4'-(4-methylpiperazin-1-yl)-3'-{[6-oxo-4-(trifluoromethyl)-5,6-dihydropyridine-3-carbonyl]amino}[1,1'-biphenyl]-3-yl]methyl}piperazin-1-yl)ethyl]amino}-11-oxoundecanoyl)-L-valyl-(4R)-4-hydroxy-N-{[4-(4-methyl-1,3-thiazol-5-yl)phenyl]methyl}-L-prolinamide, Elongin-B, ... | | Authors: | Kottur, J, Jain, R, Aggarwal, A.K. | | Deposit date: | 2020-08-18 | | Release date: | 2021-10-06 | | Last modified: | 2023-10-18 | | Method: | X-RAY DIFFRACTION (1.7 Å) | | Cite: | A selective WDR5 degrader inhibits acute myeloid leukemia in patient-derived mouse models.
Sci Transl Med, 13, 2021
|
|
7JTP
 | | Crystal structure of Protac MS67 in complex with the WD repeat-containing protein 5 and pVHL:ElonginC:ElonginB | | Descriptor: | Elongin-B, Elongin-C, GLYCEROL, ... | | Authors: | Kottur, J, Jain, R, Aggarwal, A.K. | | Deposit date: | 2020-08-18 | | Release date: | 2021-10-06 | | Last modified: | 2023-10-18 | | Method: | X-RAY DIFFRACTION (2.12 Å) | | Cite: | A selective WDR5 degrader inhibits acute myeloid leukemia in patient-derived mouse models.
Sci Transl Med, 13, 2021
|
|
7L1X
 | | Structure of human CK2 alpha kinase (catalytic subunit) with the inhibitor 108600. | | Descriptor: | (2~{Z})-6-[[2,6-bis(chloranyl)phenyl]methylsulfonyl]-2-[[4-oxidanyl-3-[oxidanyl(oxidanylidene)-$l^{4}-azanyl]phenyl]methylidene]-4~{H}-1,4-benzothiazin-3-one, Casein kinase II subunit alpha, GLYCEROL, ... | | Authors: | Rechkoblit, O, Aggarwal, A.K. | | Deposit date: | 2020-12-15 | | Release date: | 2021-08-11 | | Last modified: | 2023-10-18 | | Method: | X-RAY DIFFRACTION (1.8 Å) | | Cite: | Simultaneous CK2/TNIK/DYRK1 inhibition by 108600 suppresses triple negative breast cancer stem cells and chemotherapy-resistant disease.
Nat Commun, 12, 2021
|
|
5L2X
 | | Crystal structure of human PrimPol ternary complex | | Descriptor: | 2'-DEOXYADENOSINE 5'-TRIPHOSPHATE, CALCIUM ION, DNA (5'-D(P*GP*GP*TP*AP*GP*CP*(DDG))-3'), ... | | Authors: | Rechkoblit, O, Gupta, Y.K, Malik, R, Rajashankar, K.R, Johnson, R.E, Prakash, L, Prakash, S, Aggarwal, A.K. | | Deposit date: | 2016-08-02 | | Release date: | 2016-11-23 | | Last modified: | 2024-03-06 | | Method: | X-RAY DIFFRACTION (2.2 Å) | | Cite: | Structure and mechanism of human PrimPol, a DNA polymerase with primase activity.
Sci Adv, 2, 2016
|
|
5KQS
 | | Structure of NS5 methyltransferase from Zika virus bound to S-adenosylmethionine and 7-methyl-guanosine-5'-diphosphate | | Descriptor: | 7N-METHYL-8-HYDROGUANOSINE-5'-DIPHOSPHATE, ACETATE ION, GLYCEROL, ... | | Authors: | Coloma, J, Jain, R, Rajashankar, K.R, Aggarwal, A.K. | | Deposit date: | 2016-07-06 | | Release date: | 2016-09-14 | | Last modified: | 2023-10-04 | | Method: | X-RAY DIFFRACTION (1.5 Å) | | Cite: | Structures of NS5 Methyltransferase from Zika Virus.
Cell Rep, 16, 2016
|
|
4PTF
 | | Ternary crystal structure of yeast DNA polymerase epsilon with template G | | Descriptor: | 1,2-ETHANEDIOL, 2'-DEOXYCYTIDINE-5'-TRIPHOSPHATE, 5'-D(*AP*TP*CP*CP*TP*CP*CP*CP*CP*TP*AP*(DOC))-3', ... | | Authors: | Jain, R, Rajashankar, K.R, Buku, A, Johnson, R.E, Prakash, L, Prakash, S, Aggarwal, A.K. | | Deposit date: | 2014-03-10 | | Release date: | 2014-04-30 | | Last modified: | 2023-09-20 | | Method: | X-RAY DIFFRACTION (2.809 Å) | | Cite: | Crystal Structure of Yeast DNA Polymerase epsilon Catalytic Domain.
Plos One, 9, 2014
|
|
5WM8
 | | Structure of the 10R (+)-cis-BP-dG modified Rev1 ternary complex | | Descriptor: | 1,2,3-TRIHYDROXY-1,2,3,4-TETRAHYDROBENZO[A]PYRENE, 1,2-ETHANEDIOL, 2'-DEOXYCYTIDINE-5'-TRIPHOSPHATE, ... | | Authors: | Rechkoblit, O, Kolbanovsky, A, Landes, H, Geacintov, N.E, Aggarwal, A.K. | | Deposit date: | 2017-07-28 | | Release date: | 2017-10-25 | | Last modified: | 2023-10-04 | | Method: | X-RAY DIFFRACTION (1.92 Å) | | Cite: | Mechanism of error-free replication across benzo[a]pyrene stereoisomers by Rev1 DNA polymerase.
Nat Commun, 8, 2017
|
|
5WMB
 | | Structure of the 10S (-)-cis-BP-dG modified Rev1 ternary complex (the BP residue is disordered) | | Descriptor: | 1,2-ETHANEDIOL, 2'-DEOXYCYTIDINE-5'-TRIPHOSPHATE, DI(HYDROXYETHYL)ETHER, ... | | Authors: | Rechkoblit, O, Kolbanovsky, A, Landes, H, Geacintov, N.E, Aggarwal, A.K. | | Deposit date: | 2017-07-28 | | Release date: | 2017-10-25 | | Last modified: | 2023-10-04 | | Method: | X-RAY DIFFRACTION (2.25 Å) | | Cite: | Mechanism of error-free replication across benzo[a]pyrene stereoisomers by Rev1 DNA polymerase.
Nat Commun, 8, 2017
|
|
5WM1
 | | Structure of the 10S (+)-trans-BP-dG modified Rev1 ternary complex | | Descriptor: | 1,2,3-TRIHYDROXY-1,2,3,4-TETRAHYDROBENZO[A]PYRENE, 1,2-ETHANEDIOL, 2'-DEOXYCYTIDINE-5'-TRIPHOSPHATE, ... | | Authors: | Rechkoblit, O, Kolbanovsky, A, Landes, H, Geacintov, N.E, Aggarwal, A.K. | | Deposit date: | 2017-07-28 | | Release date: | 2017-10-25 | | Last modified: | 2023-10-04 | | Method: | X-RAY DIFFRACTION (1.85 Å) | | Cite: | Mechanism of error-free replication across benzo[a]pyrene stereoisomers by Rev1 DNA polymerase.
Nat Commun, 8, 2017
|
|
3G6V
 | |
3G6Y
 | |
3G6X
 | |
4ZCF
 | | Structural basis of asymmetric DNA methylation and ATP-triggered long-range diffusion by EcoP15I | | Descriptor: | ADENOSINE MONOPHOSPHATE, CALCIUM ION, DNA 20-mer AATCATAGTCTACTGCTGTA, ... | | Authors: | Gupta, Y.K, Chan, S.H, Xu, S.Y, Aggarwal, A.K. | | Deposit date: | 2015-04-15 | | Release date: | 2015-07-29 | | Last modified: | 2024-03-06 | | Method: | X-RAY DIFFRACTION (2.6 Å) | | Cite: | Structural basis of asymmetric DNA methylation and ATP-triggered long-range diffusion by EcoP15I.
Nat Commun, 6, 2015
|
|
2OH2
 | | Ternary Complex of Human DNA Polymerase | | Descriptor: | 5'-D(*GP*GP*G*GP*GP*AP*AP*GP*GP*AP*CP*CP*C)-3', 5'-D(*TP*T*CP*CP*AP*GP*GP*GP*TP*CP*CP*TP*TP*CP*CP*CP*CP*C)-3', DNA polymerase kappa, ... | | Authors: | Lone, S, Townson, S.A, Uljon, S.N, Prakash, S, Prakash, L, Aggarwal, A.K. | | Deposit date: | 2007-01-09 | | Release date: | 2007-02-27 | | Last modified: | 2023-12-27 | | Method: | X-RAY DIFFRACTION (3.05 Å) | | Cite: | Ternary complex of the catalytic core of human DNA polymerase Kappa with DNA and dTT
To be Published
|
|
2P0J
 | | Structure of restriction endonuclease BstYI bound to non-cognate DNA | | Descriptor: | 5'-D(*AP*TP*GP*AP*AP*TP*CP*CP*AP*TP*A)-3', 5'-D(*TP*AP*TP*GP*GP*AP*TP*TP*CP*AP*T)-3', BstYI | | Authors: | Townson, S.A, Samuelson, J.C, Bao, Y, Xu, S.Y, Aggarwal, A.K. | | Deposit date: | 2007-02-28 | | Release date: | 2007-05-01 | | Last modified: | 2024-02-21 | | Method: | X-RAY DIFFRACTION (2.1 Å) | | Cite: | BstYI Bound to Noncognate DNA Reveals a "Hemispecific" Complex: Implications for DNA Scanning.
Structure, 15, 2007
|
|
2PI0
 | | Crystal Structure of IRF-3 bound to the PRDIII-I regulatory element of the human interferon-B enhancer | | Descriptor: | Interferon regulatory factor 3, PRDIII-I region of human interferon-B promoter strand 1, PRDIII-I region of human interferon-B promoter strand 2 | | Authors: | Escalante, C.R, Nistal-Villan, E, Leyi, S, Garcia-Sastre, A, Aggarwal, A.K. | | Deposit date: | 2007-04-12 | | Release date: | 2007-10-30 | | Last modified: | 2023-08-30 | | Method: | X-RAY DIFFRACTION (2.31 Å) | | Cite: | Structure of IRF-3 bound to the PRDIII-I regulatory element of the human interferon-beta enhancer.
Mol.Cell, 26, 2007
|
|
4HTP
 | |
4HTO
 | |
6V8P
 | | Structure of DNA Polymerase Zeta (Apo) | | Descriptor: | DNA polymerase delta small subunit, DNA polymerase delta subunit 3, DNA polymerase zeta catalytic subunit, ... | | Authors: | Malik, R, Gomez-Llorente, Y, Ubarretxena-Belandia, I, Aggarwal, A.K. | | Deposit date: | 2019-12-11 | | Release date: | 2020-08-19 | | Last modified: | 2024-03-06 | | Method: | ELECTRON MICROSCOPY (4.1 Å) | | Cite: | Structure and mechanism of B-family DNA polymerase zeta specialized for translesion DNA synthesis.
Nat.Struct.Mol.Biol., 27, 2020
|
|
