4P0P
 
 | | Crystal structure of Human Mus81-Eme1 in complex with 5'-flap DNA, and Mg2+ | | Descriptor: | Crossover junction endonuclease EME1, Crossover junction endonuclease MUS81, DNA GAATGTGTGTCTCAATC, ... | | Authors: | Gwon, G.H, Baek, K, Cho, Y. | | Deposit date: | 2014-02-22 | | Release date: | 2014-05-28 | | Last modified: | 2023-12-27 | | Method: | X-RAY DIFFRACTION (2.8 Å) | | Cite: | Crystal structures of the structure-selective nuclease Mus81-Eme1 bound to flap DNA substrates.
Embo J., 33, 2014
|
|
4P0Q
 | | Crystal structure of Human Mus81-Eme1 in complex with 5'-flap DNA | | Descriptor: | Crossover junction endonuclease EME1, Crossover junction endonuclease MUS81, DNA GAATGTGTGTCTCAATC, ... | | Authors: | Gwon, G.H, Baek, K, Cho, Y. | | Deposit date: | 2014-02-22 | | Release date: | 2014-05-28 | | Last modified: | 2023-12-27 | | Method: | X-RAY DIFFRACTION (2.851 Å) | | Cite: | Crystal structures of the structure-selective nuclease Mus81-Eme1 bound to flap DNA substrates.
Embo J., 33, 2014
|
|
4P0S
 | | human Mus81-Eme1-3'flap DNA complex | | Descriptor: | Crossover junction endonuclease EME1, Crossover junction endonuclease MUS81, DNA GAATGTGTGTCT, ... | | Authors: | Gwon, G.H, Baek, K, Cho, Y. | | Deposit date: | 2014-02-22 | | Release date: | 2014-05-28 | | Last modified: | 2023-12-27 | | Method: | X-RAY DIFFRACTION (6 Å) | | Cite: | Crystal structures of the structure-selective nuclease Mus81-Eme1 bound to flap DNA substrates.
Embo J., 33, 2014
|
|
4P0R
 | | human Mus81-Eme1-3'flap DNA complex | | Descriptor: | Crossover junction endonuclease EME1, Crossover junction endonuclease MUS81, DNA ACGTGCTTACACACAGAGGTTAGGGTGAACTT, ... | | Authors: | Gwon, G.H, Baek, K, Cho, Y. | | Deposit date: | 2014-02-22 | | Release date: | 2014-05-28 | | Last modified: | 2023-12-27 | | Method: | X-RAY DIFFRACTION (6.501 Å) | | Cite: | Crystal structures of the structure-selective nuclease Mus81-Eme1 bound to flap DNA substrates.
Embo J., 33, 2014
|
|
7EWR
 | | Cryo-EM structure of human GPR158 in complex with RGS7-Gbeta5 in a 2:2:2 ratio | | Descriptor: | Guanine nucleotide-binding protein subunit beta-5, Probable G-protein coupled receptor 158, Regulator of G-protein signaling 7 | | Authors: | Kim, Y, Jeong, E, Jeong, J, Cho, Y. | | Deposit date: | 2021-05-26 | | Release date: | 2021-12-01 | | Last modified: | 2022-02-16 | | Method: | ELECTRON MICROSCOPY (4.7 Å) | | Cite: | Structure of the class C orphan GPCR GPR158 in complex with RGS7-G beta 5.
Nat Commun, 12, 2021
|
|
7EWL
 | | cryo-EM structure of apo GPR158 | | Descriptor: | Probable G-protein coupled receptor 158 | | Authors: | Jeong, E, Kim, Y, Jeong, J, Cho, Y. | | Deposit date: | 2021-05-25 | | Release date: | 2021-12-01 | | Last modified: | 2022-02-16 | | Method: | ELECTRON MICROSCOPY (3.52 Å) | | Cite: | Structure of the class C orphan GPCR GPR158 in complex with RGS7-G beta 5.
Nat Commun, 12, 2021
|
|
7EWP
 | | Cryo-EM structure of human GPR158 in complex with RGS7-Gbeta5 in a 2:1:1 ratio | | Descriptor: | Guanine nucleotide-binding protein subunit beta-5, Probable G-protein coupled receptor 158, Regulator of G-protein signaling 7 | | Authors: | Kim, Y, Jeong, E, Jeong, J, Cho, Y. | | Deposit date: | 2021-05-25 | | Release date: | 2021-12-01 | | Last modified: | 2022-02-16 | | Method: | ELECTRON MICROSCOPY (4.3 Å) | | Cite: | Structure of the class C orphan GPCR GPR158 in complex with RGS7-G beta 5.
Nat Commun, 12, 2021
|
|
4TUG
 | | Crystal structure of MjMre11-DNA2 complex | | Descriptor: | DNA (5'-D(P*CP*TP*GP*TP*CP*CP*TP*AP*CP*GP*TP*GP*CP*CP*A)-3'), DNA (5'-D(P*GP*CP*AP*CP*GP*TP*AP*GP*GP*AP*CP*AP*GP*C)-3'), DNA double-strand break repair protein Mre11, ... | | Authors: | Sung, S, Cho, Y. | | Deposit date: | 2014-06-24 | | Release date: | 2014-10-15 | | Last modified: | 2023-12-27 | | Method: | X-RAY DIFFRACTION (3.55 Å) | | Cite: | DNA end recognition by the Mre11 nuclease dimer: insights into resection and repair of damaged DNA.
Embo J., 33, 2014
|
|
4TUI
 | | Crystal structure of MjMre11-DNA1 complex | | Descriptor: | DNA (5'-D(P*TP*CP*CP*TP*AP*CP*GP*TP*GP*CP*CP*AP*G)-3'), DNA (5'-D(P*TP*GP*GP*CP*AP*CP*GP*TP*AP*GP*GP*AP*C)-3'), DNA double-strand break repair protein Mre11 | | Authors: | Sung, S, Cho, Y. | | Deposit date: | 2014-06-24 | | Release date: | 2014-10-15 | | Last modified: | 2023-12-27 | | Method: | X-RAY DIFFRACTION (3.59 Å) | | Cite: | DNA end recognition by the Mre11 nuclease dimer: insights into resection and repair of damaged DNA.
Embo J., 33, 2014
|
|
5E9F
 | | Structural insights of isocitrate lyases from Magnaporthe oryzae | | Descriptor: | Isocitrate lyase, MAGNESIUM ION | | Authors: | Park, Y, Cho, Y, Lee, Y.-H, Lee, Y.-W, Rhee, S. | | Deposit date: | 2015-10-15 | | Release date: | 2016-04-27 | | Last modified: | 2023-11-08 | | Method: | X-RAY DIFFRACTION (2.8 Å) | | Cite: | Crystal structure and functional analysis of isocitrate lyases from Magnaporthe oryzae and Fusarium graminearum
J.Struct.Biol., 194, 2016
|
|
5E9H
 | | Structural insights of isocitrate lyases from Fusarium graminearum | | Descriptor: | Isocitrate lyase, MALONATE ION, MANGANESE (II) ION | | Authors: | Park, Y, Cho, Y, Lee, Y.-H, Lee, Y.-W, Rhee, S. | | Deposit date: | 2015-10-15 | | Release date: | 2016-04-27 | | Last modified: | 2023-11-08 | | Method: | X-RAY DIFFRACTION (2.3 Å) | | Cite: | Crystal structure and functional analysis of isocitrate lyases from Magnaporthe oryzae and Fusarium graminearum
J.Struct.Biol., 194, 2016
|
|
5E9G
 | | Structural insights of isocitrate lyases from Magnaporthe oryzae | | Descriptor: | GLYCEROL, GLYOXYLIC ACID, Isocitrate lyase, ... | | Authors: | Park, Y, Cho, Y, Lee, Y.-H, Lee, Y.-W, Rhee, S. | | Deposit date: | 2015-10-15 | | Release date: | 2016-04-27 | | Last modified: | 2023-11-08 | | Method: | X-RAY DIFFRACTION (2.1 Å) | | Cite: | Crystal structure and functional analysis of isocitrate lyases from Magnaporthe oryzae and Fusarium graminearum
J.Struct.Biol., 194, 2016
|
|
7WRS
 | |
7WRU
 | |
3B64
 | |
7YQ6
 | | human insulin receptor bound with A62 DNA aptamer | | Descriptor: | IR-A62 aptamer, Isoform Short of Insulin receptor | | Authors: | Kim, J, Yunn, N, Ryu, S, Cho, Y. | | Deposit date: | 2022-08-05 | | Release date: | 2022-11-09 | | Method: | ELECTRON MICROSCOPY (4.18 Å) | | Cite: | Functional selectivity of insulin receptor revealed by aptamer-trapped receptor structures
Nat Commun, 13, 2022
|
|
7YQ3
 | | human insulin receptor bound with A43 DNA aptamer and insulin | | Descriptor: | IR-A43 aptamer, Insulin A chain, Insulin, ... | | Authors: | Kim, J, Yunn, N, Ryu, S, Cho, Y. | | Deposit date: | 2022-08-05 | | Release date: | 2022-11-09 | | Method: | ELECTRON MICROSCOPY (3.6 Å) | | Cite: | Functional selectivity of insulin receptor revealed by aptamer-trapped receptor structures
Nat Commun, 13, 2022
|
|
7YQ4
 | | human insulin receptor bound with A62 DNA aptamer and insulin - locally refined | | Descriptor: | IR-A62 aptamer, Insulin A chain, Insulin, ... | | Authors: | Kim, J, Yunn, N, Ryu, S, Cho, Y. | | Deposit date: | 2022-08-05 | | Release date: | 2022-11-09 | | Method: | ELECTRON MICROSCOPY (3.95 Å) | | Cite: | Functional selectivity of insulin receptor revealed by aptamer-trapped receptor structures
Nat Commun, 13, 2022
|
|
7YQ5
 | | human insulin receptor bound with A62 DNA aptamer and insulin | | Descriptor: | IR-A62 aptamer, Insulin A chain, Insulin, ... | | Authors: | Kim, J, Yunn, N, Ryu, S, Cho, Y. | | Deposit date: | 2022-08-05 | | Release date: | 2022-11-09 | | Method: | ELECTRON MICROSCOPY (4.27 Å) | | Cite: | Functional selectivity of insulin receptor revealed by aptamer-trapped receptor structures
Nat Commun, 13, 2022
|
|
3T1I
 | | Crystal Structure of Human Mre11: Understanding Tumorigenic Mutations | | Descriptor: | 2,3-DIHYDROXY-1,4-DITHIOBUTANE, Double-strand break repair protein MRE11A, GLYCEROL, ... | | Authors: | Park, Y.B, Chae, J, Kim, Y, Cho, Y. | | Deposit date: | 2011-07-22 | | Release date: | 2011-11-30 | | Method: | X-RAY DIFFRACTION (3 Å) | | Cite: | Crystal structure of human mre11: understanding tumorigenic mutations
Structure, 19, 2011
|
|
7CA3
 | | Cryo-EM structure of human GABA(B) receptor bound to the positive allosteric modulator rac-BHFF | | Descriptor: | (3S)-5,7-ditert-butyl-3-oxidanyl-3-(trifluoromethyl)-1-benzofuran-2-one, CHOLESTEROL, Gamma-aminobutyric acid type B receptor subunit 1, ... | | Authors: | Kim, Y, Jeong, E, Jeong, J, Kim, Y, Cho, Y. | | Deposit date: | 2020-06-08 | | Release date: | 2020-11-11 | | Method: | ELECTRON MICROSCOPY (4.5 Å) | | Cite: | Structural Basis for Activation of the Heterodimeric GABA B Receptor.
J.Mol.Biol., 432, 2020
|
|
7CA5
 | | Cryo-EM structure of human GABA(B) receptor in apo state | | Descriptor: | Gamma-aminobutyric acid type B receptor subunit 1, Gamma-aminobutyric acid type B receptor subunit 2 | | Authors: | Kim, Y, Jeong, E, Jeong, J, Kim, Y, Cho, Y. | | Deposit date: | 2020-06-08 | | Release date: | 2020-11-11 | | Last modified: | 2024-03-27 | | Method: | ELECTRON MICROSCOPY (7.6 Å) | | Cite: | Structural Basis for Activation of the Heterodimeric GABA B Receptor.
J.Mol.Biol., 432, 2020
|
|
7CUM
 | | Cryo-EM structure of human GABA(B) receptor bound to the antagonist CGP54626 | | Descriptor: | (R)-(cyclohexylmethyl)[(2S)-3-{[(1S)-1-(3,4-dichlorophenyl)ethyl]amino}-2-hydroxypropyl]phosphinic acid, CHOLESTEROL, Gamma-aminobutyric acid type B receptor subunit 1, ... | | Authors: | Kim, Y, Jeong, E, Jeong, J, Kim, Y, Cho, Y. | | Deposit date: | 2020-08-23 | | Release date: | 2020-11-11 | | Method: | ELECTRON MICROSCOPY (3.52 Å) | | Cite: | Structural Basis for Activation of the Heterodimeric GABA B Receptor.
J.Mol.Biol., 432, 2020
|
|
1GH6
 | | RETINOBLASTOMA POCKET COMPLEXED WITH SV40 LARGE T ANTIGEN | | Descriptor: | Large T antigen, Retinoblastoma-associated protein | | Authors: | Kim, H.Y, Cho, Y. | | Deposit date: | 2000-11-15 | | Release date: | 2001-11-15 | | Last modified: | 2023-08-09 | | Method: | X-RAY DIFFRACTION (3.2 Å) | | Cite: | Structural basis for the inactivation of retinoblastoma tumor suppressor by SV40 large T antigen.
EMBO J., 20, 2001
|
|
5GOX
 | | Eukaryotic Rad50 Functions as A Rod-shaped Dimer | | Descriptor: | DNA repair protein RAD50, GLYCEROL, ZINC ION | | Authors: | Park, Y.B, Hohl, M, Padjasek, M, Jeong, E, Jin, K.S, Krezel, A, Petrini, J.H.J, Cho, Y. | | Deposit date: | 2016-07-30 | | Release date: | 2017-02-01 | | Last modified: | 2017-03-15 | | Method: | X-RAY DIFFRACTION (2.405 Å) | | Cite: | Eukaryotic Rad50 functions as a rod-shaped dimer
Nat. Struct. Mol. Biol., 24, 2017
|
|
