2HIO
 
 | | HISTONE OCTAMER (CHICKEN), CHROMOSOMAL PROTEIN | | Descriptor: | PROTEIN (HISTONE H2A), PROTEIN (HISTONE H2B), PROTEIN (HISTONE H3), ... | | Authors: | Arents, G, Moudrianakis, E.N. | | Deposit date: | 1999-06-15 | | Release date: | 2000-01-12 | | Last modified: | 2023-12-27 | | Method: | X-RAY DIFFRACTION (3.1 Å) | | Cite: | The nucleosomal core histone octamer at 3.1 A resolution: a tripartite protein assembly and a left-handed superhelix.
Proc.Natl.Acad.Sci.USA, 88, 1991
|
|
2HUE
 | | Structure of the H3-H4 chaperone Asf1 bound to histones H3 and H4 | | Descriptor: | Anti-silencing protein 1, GLYCEROL, Histone H3, ... | | Authors: | English, C.M, Churchill, M.E.A, Tyler, J.K. | | Deposit date: | 2006-07-26 | | Release date: | 2006-11-21 | | Last modified: | 2024-02-14 | | Method: | X-RAY DIFFRACTION (1.7 Å) | | Cite: | Structural basis for the histone chaperone activity of asf1.
Cell(Cambridge,Mass.), 127, 2006
|
|
4NFT
 | | Crystal structure of human lnkH2B-h2A.Z-Anp32e | | Descriptor: | Acidic leucine-rich nuclear phosphoprotein 32 family member E, Histone H2B type 2-E, Histone H2A.Z | | Authors: | Shan, S, Pan, L, Mao, Z, Wang, W, Sun, J, Dong, Q, Liang, X, Ding, X, Chen, S, Dai, L, Zhang, Z, Zhu, B, Zhou, Z. | | Deposit date: | 2013-11-01 | | Release date: | 2014-04-09 | | Last modified: | 2024-03-20 | | Method: | X-RAY DIFFRACTION (2.61 Å) | | Cite: | Anp32e, a higher eukaryotic histone chaperone directs preferential recognition for H2A.Z
Cell Res., 24, 2014
|
|
2IO5
 | | Crystal structure of the CIA- histone H3-H4 complex | | Descriptor: | ASF1A protein, Histone H3.1, Histone H4 | | Authors: | Natsume, R, Akai, Y, Horikoshi, M, Senda, T. | | Deposit date: | 2006-10-10 | | Release date: | 2007-02-27 | | Last modified: | 2023-10-25 | | Method: | X-RAY DIFFRACTION (2.7 Å) | | Cite: | Structure and function of the histone chaperone CIA/ASF1 complexed with histones H3 and H4.
Nature, 446, 2007
|
|
2PYO
 | | Drosophila nucleosome core | | Descriptor: | CHLORIDE ION, DNA (147-MER), Histone H2A, ... | | Authors: | Clapier, C.R, Petosa, C, Mueller, C.W. | | Deposit date: | 2007-05-16 | | Release date: | 2007-11-06 | | Last modified: | 2024-02-21 | | Method: | X-RAY DIFFRACTION (2.43 Å) | | Cite: | Structure of the Drosophila nucleosome core particle highlights evolutionary constraints on the H2A-H2B histone dimer.
Proteins, 71, 2007
|
|
2JSS
 | | NMR structure of chaperone Chz1 complexed with histone H2A.Z-H2B | | Descriptor: | Chimera of Histone H2B.1 and Histone H2A.Z, Uncharacterized protein YER030W | | Authors: | Zhou, Z, Feng, H, Hansen, D.F, Kato, H, Luk, E, Freedberg, D.I, Kay, L.E, Wu, C, Bai, Y. | | Deposit date: | 2007-07-11 | | Release date: | 2008-05-20 | | Last modified: | 2021-08-18 | | Method: | SOLUTION NMR | | Cite: | NMR structure of chaperone Chz1 complexed with histones H2A.Z-H2B.
Nat.Struct.Mol.Biol., 15, 2008
|
|
2RVQ
 | | Solution structure of the isolated histone H2A-H2B heterodimer | | Descriptor: | Histone H2A type 1-B/E, Histone H2B type 1-J | | Authors: | Moriwaki, Y, Yamane, T, Ohtomo, H, Ikeguchi, M, Kurita, J, Sato, M, Nagadoi, A, Shimojo, H, Nishimura, Y. | | Deposit date: | 2016-03-28 | | Release date: | 2016-05-25 | | Method: | SOLUTION NMR | | Cite: | Solution structure of the isolated histone H2A-H2B heterodimer
Sci Rep, 6, 2016
|
|
5NL0
 | | Crystal structure of a 197-bp palindromic 601L nucleosome in complex with linker histone H1 | | Descriptor: | DNA (197-MER), Histone H1.0-B, Histone H2A type 1, ... | | Authors: | Garcia-Saez, I, Petosa, C, Dimitrov, S. | | Deposit date: | 2017-04-03 | | Release date: | 2017-05-17 | | Last modified: | 2024-01-17 | | Method: | X-RAY DIFFRACTION (5.4 Å) | | Cite: | Structure and Dynamics of a 197 bp Nucleosome in Complex with Linker Histone H1.
Mol. Cell, 66, 2017
|
|
5O9G
 | | Structure of nucleosome-Chd1 complex | | Descriptor: | ADENOSINE-5'-DIPHOSPHATE, BERYLLIUM TRIFLUORIDE ION, Chromo domain-containing protein 1, ... | | Authors: | Farnung, L, Vos, S.M, Wigge, C, Cramer, P. | | Deposit date: | 2017-06-19 | | Release date: | 2017-10-11 | | Last modified: | 2017-11-01 | | Method: | ELECTRON MICROSCOPY (4.8 Å) | | Cite: | Nucleosome-Chd1 structure and implications for chromatin remodelling.
Nature, 550, 2017
|
|
5OMX
 | |
5OXV
 | | Structure of the 4_601_157 tetranucleosome (C2 form) | | Descriptor: | DNA STRAND 1 (601-based sequence model), DNA STRAND 2 (601-based sequence model), Histone H2A, ... | | Authors: | Ekundayo, B, Schalch, T. | | Deposit date: | 2017-09-07 | | Release date: | 2017-10-11 | | Last modified: | 2024-01-17 | | Method: | X-RAY DIFFRACTION (6.721 Å) | | Cite: | Capturing Structural Heterogeneity in Chromatin Fibers.
J. Mol. Biol., 429, 2017
|
|
5ONG
 | | X-Ray crystal structure of a nucleosome core particle with its DNA site-specifically crosslinked to the histone octamer | | Descriptor: | CHLORIDE ION, DNA (147-MER), Histone H2A, ... | | Authors: | Frouws, T.D, Barth, P.D, Richmond, T.J. | | Deposit date: | 2017-08-03 | | Release date: | 2017-11-22 | | Last modified: | 2024-01-17 | | Method: | X-RAY DIFFRACTION (2.797 Å) | | Cite: | Site-Specific Disulfide Crosslinked Nucleosomes with Enhanced Stability.
J. Mol. Biol., 430, 2018
|
|
5OY7
 | | Structure of the 4_601_157 tetranucleosome (P1 form) | | Descriptor: | CHLORIDE ION, DNA (619-MER), Histone H2A, ... | | Authors: | Ekundayo, B, Richmond, T.J, Schalch, T. | | Deposit date: | 2017-09-07 | | Release date: | 2017-09-20 | | Last modified: | 2024-01-17 | | Method: | X-RAY DIFFRACTION (5.774 Å) | | Cite: | Capturing Structural Heterogeneity in Chromatin Fibers.
J. Mol. Biol., 429, 2017
|
|
5ONW
 | | X-Ray crystal structure of a nucleosome core particle with its DNA site-specifically crosslinked to the histone octamer and the two H2A/H2B dimers crosslinked via H2A N38C | | Descriptor: | CHLORIDE ION, DNA (147-MER), Histone H2A, ... | | Authors: | Frouws, T.D, Barth, P.D, Richmond, T.J. | | Deposit date: | 2017-08-04 | | Release date: | 2017-11-22 | | Last modified: | 2024-01-17 | | Method: | X-RAY DIFFRACTION (2.8 Å) | | Cite: | Site-Specific Disulfide Crosslinked Nucleosomes with Enhanced Stability.
J. Mol. Biol., 430, 2018
|
|
7PFT
 | |
7PFU
 | |
7PJ1
 | |
7PII
 | | Structure of the human CCAN CENP-A alpha-satellite complex | | Descriptor: | Centromere protein C, DNA (122-MER), DNA (123-MER), ... | | Authors: | Yatskevich, S, Muir, K.W, Bellini, D, Barford, D. | | Deposit date: | 2021-08-19 | | Release date: | 2022-05-25 | | Last modified: | 2022-06-01 | | Method: | ELECTRON MICROSCOPY (2.68 Å) | | Cite: | Structure of the human inner kinetochore bound to a centromeric CENP-A nucleosome.
Science, 376, 2022
|
|
7R5R
 | | Structure of the human CCAN CENP-A alpha-satellite complex | | Descriptor: | Centromere protein C, DNA (171-MER), Histone H2A type 1-C, ... | | Authors: | Yatskevich, S, Muir, K.W, Bellini, D, Zhang, Z, Yang, J, Tischer, T, Predin, M, Dendooven, T, McLaughlin, S.H, Barford, D. | | Deposit date: | 2022-02-11 | | Release date: | 2022-04-27 | | Last modified: | 2022-06-01 | | Method: | ELECTRON MICROSCOPY (2.44 Å) | | Cite: | Structure of the human inner kinetochore bound to a centromeric CENP-A nucleosome.
Science, 376, 2022
|
|
1HQ3
 | | CRYSTAL STRUCTURE OF THE HISTONE-CORE-OCTAMER IN KCL/PHOSPHATE | | Descriptor: | CHLORIDE ION, HISTONE H2A-IV, HISTONE H2B, ... | | Authors: | Chantalat, L, Nicholson, J.M, Lambert, S.J, Reid, A.J, Donovan, M.J, Reynolds, C.D, Wood, C.M, Baldwin, J.P. | | Deposit date: | 2000-12-14 | | Release date: | 2001-01-24 | | Last modified: | 2023-08-09 | | Method: | X-RAY DIFFRACTION (2.15 Å) | | Cite: | Structure of the histone-core octamer in KCl/phosphate crystals at 2.15 A resolution.
Acta Crystallogr.,Sect.D, 59, 2003
|
|
1ID3
 | | CRYSTAL STRUCTURE OF THE YEAST NUCLEOSOME CORE PARTICLE REVEALS FUNDAMENTAL DIFFERENCES IN INTER-NUCLEOSOME INTERACTIONS | | Descriptor: | HISTONE H2A.1, HISTONE H2B.2, HISTONE H3, ... | | Authors: | White, C.L, Suto, R.K, Luger, K. | | Deposit date: | 2001-04-03 | | Release date: | 2001-09-28 | | Last modified: | 2023-08-09 | | Method: | X-RAY DIFFRACTION (3.1 Å) | | Cite: | Structure of the yeast nucleosome core particle reveals fundamental changes in internucleosome interactions.
EMBO J., 20, 2001
|
|
1HIO
 | | HISTONE OCTAMER (CHICKEN), CHROMOSOMAL PROTEIN, ALPHA CARBONS ONLY | | Descriptor: | HISTONE H2A, HISTONE H2B, HISTONE H3, ... | | Authors: | Arents, G, Moudrianakis, E.N. | | Deposit date: | 1991-09-19 | | Release date: | 1998-11-25 | | Last modified: | 2024-02-07 | | Method: | X-RAY DIFFRACTION (3.1 Å) | | Cite: | The nucleosomal core histone octamer at 3.1 A resolution: a tripartite protein assembly and a left-handed superhelix.
Proc.Natl.Acad.Sci.USA, 88, 1991
|
|
1KX3
 | | X-Ray Structure of the Nucleosome Core Particle, NCP146, at 2.0 A Resolution | | Descriptor: | DNA (5'(ATCAATATCCACCTGCAGATTCTACCAAAAGTGTATTTGGAAACTGCTCCATCAAAAGGCATGTTCAGCTGAATTCAGCTGAACATGCCTTTTGATGGAGCAGTTTCCAAATACACTTTTGGTAGAATCTGCAGGTGGATATTGAT)3'), MANGANESE (II) ION, histone H2A.1, ... | | Authors: | Davey, C.A, Sargent, D.F, Luger, K, Maeder, A.W, Richmond, T.J. | | Deposit date: | 2002-01-31 | | Release date: | 2002-12-25 | | Last modified: | 2023-08-16 | | Method: | X-RAY DIFFRACTION (2 Å) | | Cite: | Solvent Mediated Interactions in the Structure of the Nucleosome Core Particle at 1.9 A Resolution
J.Mol.Biol., 319, 2002
|
|
1KX5
 | | X-Ray Structure of the Nucleosome Core Particle, NCP147, at 1.9 A Resolution | | Descriptor: | CHLORIDE ION, DNA (5'(ATCAATATCCACCTGCAGATACTACCAAAAGTGTATTTGGAAACTGCTCCATCAAAAGGCATGTTCAGCTGGAATCCAGCTGAACATGCCTTTTGATGGAGCAGTTTCCAAATACACTTTTGGTAGTATCTGCAGGTGGATATTGAT)3'), DNA (5'(ATCAATATCCACCTGCAGATACTACCAAAAGTGTATTTGGAAACTGCTCCATCAAAAGGCATGTTCAGCTGGATTCCAGCTGAACATGCCTTTTGATGGAGCAGTTTCCAAATACACTTTTGGTAGTATCTGCAGGTGGATATTGAT)3'), ... | | Authors: | Davey, C.A, Sargent, D.F, Luger, K, Maeder, A.W, Richmond, T.J. | | Deposit date: | 2002-01-31 | | Release date: | 2002-12-25 | | Last modified: | 2023-08-16 | | Method: | X-RAY DIFFRACTION (1.94 Å) | | Cite: | Solvent Mediated Interactions in the Structure of the Nucleosome Core Particle at 1.9 A Resolution
J.Mol.Biol., 319, 2002
|
|
1KX4
 | | X-Ray Structure of the Nucleosome Core Particle, NCP146b, at 2.6 A Resolution | | Descriptor: | CHLORIDE ION, DNA (5'(ATCTCCAAATATCCCTTGCGGATCGTAGAAAAAGTGTGTCAAACTGCGCTATCAAAGGGAAACTTCAACTGAATTCAGTTGAAGTTTCCCTTTGATAGCGCAGTTTGACACACTTTTTCTACGATCCGCAAGGGATATTTGGAGAT)3'), MANGANESE (II) ION, ... | | Authors: | Davey, C.A, Sargent, D.F, Luger, K, Maeder, A.W, Richmond, T.J. | | Deposit date: | 2002-01-31 | | Release date: | 2002-12-25 | | Last modified: | 2023-08-16 | | Method: | X-RAY DIFFRACTION (2.6 Å) | | Cite: | Solvent Mediated Interactions in the Structure of the Nucleosome Core Particle at 1.9 A Resolution
J.Mol.Biol., 319, 2002
|
|
