5GT0
 
 | | Crystal structure of nucleosome complex with human testis-specific histone variants, Th2a | | Descriptor: | CHLORIDE ION, DNA (146-MER), Histone H2A type 1-A, ... | | Authors: | Kumarevel, T, Sivaraman, P. | | Deposit date: | 2016-08-18 | | Release date: | 2017-02-15 | | Last modified: | 2022-05-04 | | Method: | X-RAY DIFFRACTION (2.82 Å) | | Cite: | Structural analyses of the nucleosome complexes with human testis-specific histone variants, hTh2a and hTh2b
Biophys. Chem., 221, 2017
|
|
5GXQ
 | | The crystal structure of the nucleosome containing H3.6 | | Descriptor: | DNA (146-MER), Histone H2A type 1-B/E, Histone H2B type 1-J, ... | | Authors: | Taguchi, H, Xie, Y, Horikoshi, N, Kurumizaka, H. | | Deposit date: | 2016-09-19 | | Release date: | 2017-04-19 | | Last modified: | 2023-11-08 | | Method: | X-RAY DIFFRACTION (2.85 Å) | | Cite: | Crystal Structure and Characterization of Novel Human Histone H3 Variants, H3.6, H3.7, and H3.8
Biochemistry, 56, 2017
|
|
5GSU
 | | Crystal structure of nucleosome core particle consisting of human testis-specific histone variants, Th2A and Th2B | | Descriptor: | CHLORIDE ION, DNA (146-MER), Histone H2A type 1-A, ... | | Authors: | Kumarevel, T, Sivaraman, P. | | Deposit date: | 2016-08-17 | | Release date: | 2017-02-15 | | Last modified: | 2023-11-08 | | Method: | X-RAY DIFFRACTION (3.1 Å) | | Cite: | Structural analyses of the nucleosome complexes with human testis-specific histone variants, hTh2a and hTh2b
Biophys. Chem., 221, 2017
|
|
5GSE
 | | Crystal structure of unusual nucleosome | | Descriptor: | DNA (250-MER), Histone H2A type 1-B/E, Histone H2B type 1-J, ... | | Authors: | Kato, D, Osakabe, A, Arimura, Y, Park, S.Y, Kurumizaka, H. | | Deposit date: | 2016-08-16 | | Release date: | 2017-05-03 | | Last modified: | 2023-11-08 | | Method: | X-RAY DIFFRACTION (3.14 Å) | | Cite: | Crystal structure of the overlapping dinucleosome composed of hexasome and octasome
Science, 356, 2017
|
|
5GTC
 | | Crystal structure of complex between DMAP-SH conjugated with a Kaposi's sarcoma herpesvirus LANA peptide (5-15) and nucleosome core particle | | Descriptor: | CHLORIDE ION, DNA (146-MER), Histone H2A type 1-B/E, ... | | Authors: | Arimura, Y, Kato, D, Suto, H, Kurumizaka, H, Kawashima, S.A, Yamatsugu, K, Kanai, M. | | Deposit date: | 2016-08-19 | | Release date: | 2017-06-28 | | Last modified: | 2023-11-08 | | Method: | X-RAY DIFFRACTION (2.7 Å) | | Cite: | Synthetic Posttranslational Modifications: Chemical Catalyst-Driven Regioselective Histone Acylation of Native Chromatin.
J. Am. Chem. Soc., 139, 2017
|
|
5GT3
 | | Crystal structure of nucleosome particle in the presence of human testis-specific histone variant, hTh2b | | Descriptor: | CHLORIDE ION, DNA (146-MER), Histone H2A type 1-D, ... | | Authors: | Kumarevel, T, Sivaraman, P. | | Deposit date: | 2016-08-18 | | Release date: | 2017-02-15 | | Last modified: | 2023-11-08 | | Method: | X-RAY DIFFRACTION (2.91 Å) | | Cite: | Structural analyses of the nucleosome complexes with human testis-specific histone variants, hTh2a and hTh2b
Biophys. Chem., 221, 2017
|
|
5G2E
 | | Structure of the Nap1 H2A H2B complex | | Descriptor: | HISTONE H2A TYPE 1, HISTONE H2B 1.1, NUCLEOSOME ASSEMBLY PROTEIN | | Authors: | AguilarGurrieri, C, Larabi, A, Vinayachandran, V, Patel, N.A, Yen, K, Reja, R, Ebong, I.O, Schoehn, G, Robinson, C.V, Pugh, B.F, Panne, D. | | Deposit date: | 2016-04-07 | | Release date: | 2016-08-03 | | Last modified: | 2024-01-10 | | Method: | X-RAY DIFFRACTION (6.7 Å) | | Cite: | Structural Evidence for Nap1-Dependent H2A-H2B Deposition and Nucleosome Assembly.
Embo J., 35, 2016
|
|
5G49
 | | Crystal structure of the Arabodopsis thaliana histone-fold dimer L1L NF-YC3 | | Descriptor: | ACETATE ION, CALCIUM ION, NUCLEAR TRANSCRIPTION FACTOR Y SUBUNIT B-6, ... | | Authors: | Gnesutta, N, Saad, D, Chaves-Sanjuan, A, Mantovani, R, Nardini, M. | | Deposit date: | 2016-05-06 | | Release date: | 2016-12-07 | | Last modified: | 2024-01-10 | | Method: | X-RAY DIFFRACTION (2.3 Å) | | Cite: | Crystal Structure of the Arabidopsis thaliana L1L/NF-YC3 Histone-fold Dimer Reveals Specificities of the LEC1 Family of NF-Y Subunits in Plants.
Mol Plant, 10, 2017
|
|
5HQ2
 | | Structural model of Set8 histone H4 Lys20 methyltransferase bound to nucleosome core particle | | Descriptor: | DNA (149-MER), Guanine nucleotide exchange factor SRM1, Histone H2A, ... | | Authors: | Tavarekere, G, McGinty, R.K, Tan, S. | | Deposit date: | 2016-01-21 | | Release date: | 2016-03-23 | | Last modified: | 2024-03-06 | | Method: | X-RAY DIFFRACTION (4.5 Å) | | Cite: | Multivalent Interactions by the Set8 Histone Methyltransferase With Its Nucleosome Substrate.
J.Mol.Biol., 428, 2016
|
|
7KTQ
 | | Nucleosome from a dimeric PRC2 bound to a nucleosome | | Descriptor: | 601 DNA (167-MER), Histone H2A, Histone H2B, ... | | Authors: | Grau, D.J, Armache, K.J. | | Deposit date: | 2020-11-24 | | Release date: | 2021-02-03 | | Last modified: | 2024-03-06 | | Method: | ELECTRON MICROSCOPY (3.3 Å) | | Cite: | Structures of monomeric and dimeric PRC2:EZH1 reveal flexible modules involved in chromatin compaction.
Nat Commun, 12, 2021
|
|
7LYA
 | | Cryo-EM structure of the human nucleosome core particle with linked histone proteins H2A and H2B | | Descriptor: | DNA (146-MER), DNA (147-MER), Histone H2A type 1-B/E, ... | | Authors: | Hu, Q, Botuyan, M.V, Zhao, D, Cui, D, Mer, E, Mer, G. | | Deposit date: | 2021-03-06 | | Release date: | 2021-07-28 | | Last modified: | 2021-09-01 | | Method: | ELECTRON MICROSCOPY (2.91 Å) | | Cite: | Mechanisms of BRCA1-BARD1 nucleosome recognition and ubiquitylation.
Nature, 596, 2021
|
|
7M1X
 | |
7MBM
 | | Cryo-EM structure of MLL1-NCP (H3K4M) complex, mode01 | | Descriptor: | DNA (145-MER), Histone H2A, Histone H2B 1.1, ... | | Authors: | Park, S.H, Ayoub, A, Lee, Y.T, Dou, Y, Cho, U. | | Deposit date: | 2021-04-01 | | Release date: | 2021-12-29 | | Last modified: | 2022-01-19 | | Method: | ELECTRON MICROSCOPY | | Cite: | Regulation of MLL1 Methyltransferase Activity in Two Distinct Nucleosome Binding Modes.
Biochemistry, 61, 2022
|
|
7MBN
 | | Cryo-EM structure of MLL1-NCP (H3K4M) complex, mode02 | | Descriptor: | DNA (146-MER), Histone H2A, Histone H2B 1.1, ... | | Authors: | Park, S.H, Ayoub, A, Lee, Y.T, Dou, Y, Cho, U. | | Deposit date: | 2021-04-01 | | Release date: | 2021-12-29 | | Last modified: | 2022-01-19 | | Method: | ELECTRON MICROSCOPY | | Cite: | Regulation of MLL1 Methyltransferase Activity in Two Distinct Nucleosome Binding Modes.
Biochemistry, 61, 2022
|
|
7NKY
 | | RNA Polymerase II-Spt4/5-nucleosome-FACT structure | | Descriptor: | Chromatin elongation factor SPT4, DNA (138-MER), DNA (148-MER), ... | | Authors: | Farnung, L, Ochmann, M, Engeholm, M, Cramer, P. | | Deposit date: | 2021-02-19 | | Release date: | 2021-07-07 | | Method: | ELECTRON MICROSCOPY (3.2 Å) | | Cite: | Structural basis of nucleosome transcription mediated by Chd1 and FACT.
Nat.Struct.Mol.Biol., 28, 2021
|
|
7NL0
 | | Cryo-EM structure of the Lin28B nucleosome core particle | | Descriptor: | DNA (131-MER), Histone H2A type 1-B/E, Histone H2B type 1-J, ... | | Authors: | Roberts, G.A, Ozkan, B, Gachulincova, I, O Dwyer, M.R, Hall-Ponsele, E, Saxena, M, Robinson, P.J, Soufi, A. | | Deposit date: | 2021-02-19 | | Release date: | 2021-08-11 | | Last modified: | 2021-09-29 | | Method: | ELECTRON MICROSCOPY (3.5 Å) | | Cite: | Dissecting OCT4 defines the role of nucleosome binding in pluripotency.
Nat.Cell Biol., 23, 2021
|
|
7NKX
 | | RNA polymerase II-Spt4/5-nucleosome-Chd1 structure | | Descriptor: | ADENOSINE-5'-DIPHOSPHATE, BERYLLIUM TRIFLUORIDE ION, Chromatin elongation factor SPT4, ... | | Authors: | Farnung, L, Ochmann, M, Engeholm, M, Cramer, P. | | Deposit date: | 2021-02-19 | | Release date: | 2021-08-25 | | Method: | ELECTRON MICROSCOPY (2.9 Å) | | Cite: | Structural basis of nucleosome transcription mediated by Chd1 and FACT.
Nat.Struct.Mol.Biol., 28, 2021
|
|
1KX3
 | | X-Ray Structure of the Nucleosome Core Particle, NCP146, at 2.0 A Resolution | | Descriptor: | DNA (5'(ATCAATATCCACCTGCAGATTCTACCAAAAGTGTATTTGGAAACTGCTCCATCAAAAGGCATGTTCAGCTGAATTCAGCTGAACATGCCTTTTGATGGAGCAGTTTCCAAATACACTTTTGGTAGAATCTGCAGGTGGATATTGAT)3'), MANGANESE (II) ION, histone H2A.1, ... | | Authors: | Davey, C.A, Sargent, D.F, Luger, K, Maeder, A.W, Richmond, T.J. | | Deposit date: | 2002-01-31 | | Release date: | 2002-12-25 | | Last modified: | 2023-08-16 | | Method: | X-RAY DIFFRACTION (2 Å) | | Cite: | Solvent Mediated Interactions in the Structure of the Nucleosome Core Particle at 1.9 A Resolution
J.Mol.Biol., 319, 2002
|
|
1KX5
 | | X-Ray Structure of the Nucleosome Core Particle, NCP147, at 1.9 A Resolution | | Descriptor: | CHLORIDE ION, DNA (5'(ATCAATATCCACCTGCAGATACTACCAAAAGTGTATTTGGAAACTGCTCCATCAAAAGGCATGTTCAGCTGGAATCCAGCTGAACATGCCTTTTGATGGAGCAGTTTCCAAATACACTTTTGGTAGTATCTGCAGGTGGATATTGAT)3'), DNA (5'(ATCAATATCCACCTGCAGATACTACCAAAAGTGTATTTGGAAACTGCTCCATCAAAAGGCATGTTCAGCTGGATTCCAGCTGAACATGCCTTTTGATGGAGCAGTTTCCAAATACACTTTTGGTAGTATCTGCAGGTGGATATTGAT)3'), ... | | Authors: | Davey, C.A, Sargent, D.F, Luger, K, Maeder, A.W, Richmond, T.J. | | Deposit date: | 2002-01-31 | | Release date: | 2002-12-25 | | Last modified: | 2023-08-16 | | Method: | X-RAY DIFFRACTION (1.94 Å) | | Cite: | Solvent Mediated Interactions in the Structure of the Nucleosome Core Particle at 1.9 A Resolution
J.Mol.Biol., 319, 2002
|
|
1KX4
 | | X-Ray Structure of the Nucleosome Core Particle, NCP146b, at 2.6 A Resolution | | Descriptor: | CHLORIDE ION, DNA (5'(ATCTCCAAATATCCCTTGCGGATCGTAGAAAAAGTGTGTCAAACTGCGCTATCAAAGGGAAACTTCAACTGAATTCAGTTGAAGTTTCCCTTTGATAGCGCAGTTTGACACACTTTTTCTACGATCCGCAAGGGATATTTGGAGAT)3'), MANGANESE (II) ION, ... | | Authors: | Davey, C.A, Sargent, D.F, Luger, K, Maeder, A.W, Richmond, T.J. | | Deposit date: | 2002-01-31 | | Release date: | 2002-12-25 | | Last modified: | 2023-08-16 | | Method: | X-RAY DIFFRACTION (2.6 Å) | | Cite: | Solvent Mediated Interactions in the Structure of the Nucleosome Core Particle at 1.9 A Resolution
J.Mol.Biol., 319, 2002
|
|
3KWQ
 | |
3KUY
 | |
3KXB
 | |
1M18
 | | LIGAND BINDING ALTERS THE STRUCTURE AND DYNAMICS OF NUCLEOSOMAL DNA | | Descriptor: | Histone H2A.1, Histone H2B.1, Histone H3.2, ... | | Authors: | Suto, R.K, Edayathumangalam, R.S, White, C.L, Melander, C, Gottesfeld, J.M, Dervan, P.B, Luger, K. | | Deposit date: | 2002-06-18 | | Release date: | 2003-02-18 | | Last modified: | 2024-02-14 | | Method: | X-RAY DIFFRACTION (2.45 Å) | | Cite: | Crystal Structures of Nucleosome Core Particles in Complex with Minor Groove DNA-binding Ligands
J.Mol.Biol., 326, 2003
|
|
1M19
 | | LIGAND BINDING ALTERS THE STRUCTURE AND DYNAMICS OF NUCLEOSOMAL DNA | | Descriptor: | 3-AMINO-(DIMETHYLPROPYLAMINE), 4-AMINO-(1-METHYLIMIDAZOLE)-2-CARBOXYLIC ACID, 4-AMINO-(1-METHYLPYRROLE)-2-CARBOXYLIC ACID, ... | | Authors: | Suto, R.K, Edayathumangalam, R.S, White, C.L, Melander, C, Gottesfeld, J.M, Dervan, P.B, Luger, K. | | Deposit date: | 2002-06-18 | | Release date: | 2003-02-18 | | Last modified: | 2023-11-15 | | Method: | X-RAY DIFFRACTION (2.3 Å) | | Cite: | Crystal Structures of Nucleosome Core Particles in Complex with Minor Groove DNA-binding Ligands
J.Mol.Biol., 326, 2003
|
|
