PDB: 498 resultsInfo pagesStatus searchChemie searchBIRD

---

7KI3	Human Argonaute2:miR-122 bound to the HCV genotype 1a site-1 RNA Descriptor: BARIUM ION, HCV genotype 1a miR-122 site-1, Protein argonaute-2, ... Authors: Gebert, L.F.R, MacRae, I.J. Deposit date: 2020-10-22 Release date: 2021-10-06 Last modified: 2023-10-18 Method: X-RAY DIFFRACTION (3 Å) Cite: A structured RNA motif locks Argonaute2:miR-122 onto the 5' end of the HCV genome. Nat Commun, 12, 2021
2Q1O	Crystal Structure Analysis of the RNA Dodecamer CGC-NF2-AAUUGGCG, with an Incorporated 2,4-Difluorotoluyl Residue (NF2) Descriptor: RNA (5'-R(*CP*GP*CP*(NF2)P*AP*AP*UP*UP*GP*GP*CP*G)-3') Authors: Li, F, Pallan, P.S. Deposit date: 2007-05-25 Release date: 2007-10-30 Last modified: 2024-04-03 Method: X-RAY DIFFRACTION (1.1 Å) Cite: Crystal structure, stability and in vitro RNAi activity of oligoribonucleotides containing the ribo-difluorotoluyl nucleotide: insights into substrate requirements by the human RISC Ago2 enzyme. Nucleic Acids Res., 35, 2007
2Q1R	Crystal Structure Analysis of the RNA Dodecamer CGCGAAUUAGCG, with a G-A mismatch. Descriptor: MAGNESIUM ION, RNA (5'-R(*CP*GP*CP*GP*AP*AP*UP*UP*AP*GP*CP*G)-3') Authors: Li, F, Pallan, P.S. Deposit date: 2007-05-25 Release date: 2007-10-30 Last modified: 2024-04-03 Method: X-RAY DIFFRACTION (1.12 Å) Cite: Crystal structure, stability and in vitro RNAi activity of oligoribonucleotides containing the ribo-difluorotoluyl nucleotide: insights into substrate requirements by the human RISC Ago2 enzyme. Nucleic Acids Res., 35, 2007
6CBD	Crystal Structure of Human Argonaute2 Bound to Three Tryptophans Descriptor: Guide RNA, ISOPROPYL ALCOHOL, MAGNESIUM ION, ... Authors: Sheu-Gruttadauria, J, MacRae, I.J. Deposit date: 2018-02-02 Release date: 2018-04-18 Last modified: 2024-03-13 Method: X-RAY DIFFRACTION (2.203 Å) Cite: Phase Transitions in the Assembly and Function of Human miRISC. Cell, 173, 2018
7ROZ	Structure of RNA-dependent RNA polymerase 2 (RDR2) from Arabidopsis thaliana Descriptor: MAGNESIUM ION, RNA-dependent RNA polymerase 2 Authors: Fukudome, A, Pikaard, C.S, Takagi, Y. Deposit date: 2021-08-02 Release date: 2021-12-08 Last modified: 2022-06-22 Method: ELECTRON MICROSCOPY (3.1 Å) Cite: Structure and RNA template requirements of Arabidopsis RNA-DEPENDENT RNA POLYMERASE 2. Proc.Natl.Acad.Sci.USA, 118, 2021
7RQS	Arabidopsis RNA-dependent RNA polymerase 2 Descriptor: MAGNESIUM ION, RNA-dependent RNA polymerase 2 Authors: Fukudome, A, Pikaard, C.S, Takagi, Y. Deposit date: 2021-08-07 Release date: 2021-12-08 Last modified: 2022-06-22 Method: ELECTRON MICROSCOPY (3.57 Å) Cite: Structure and RNA template requirements of Arabidopsis RNA-DEPENDENT RNA POLYMERASE 2. Proc.Natl.Acad.Sci.USA, 118, 2021
4W5T	The Crystal Structure of Human Argonaute2 Bound to a Guide and Target RNA Containing Seed Pairing from 2-7 Descriptor: MAGNESIUM ION, PHENOL, Protein argonaute-2, ... Authors: Schirle, N.T, MacRae, I.J. Deposit date: 2014-08-18 Release date: 2014-11-12 Last modified: 2023-09-27 Method: X-RAY DIFFRACTION (2.5 Å) Cite: Gene regulation. Structural basis for microRNA targeting. Science, 346, 2014
4W5O	The Crystal Structure of Human Argonaute2 Bound to a Guide and Target RNA Containing Seed Pairing from 2-9 Descriptor: ISOPROPYL ALCOHOL, MAGNESIUM ION, PHENOL, ... Authors: Schirle, N.T, MacRae, I.J. Deposit date: 2014-08-18 Release date: 2014-11-12 Last modified: 2023-09-27 Method: X-RAY DIFFRACTION (1.802 Å) Cite: Gene regulation. Structural basis for microRNA targeting. Science, 346, 2014
4W5N	The Crystal Structure of Human Argonaute2 Bound to a Defined Guide RNA Descriptor: MAGNESIUM ION, PHENOL, Protein argonaute-2, ... Authors: Schirle, N.T, Sheu-Gruttadauria, J, MacRae, I.J. Deposit date: 2014-08-18 Release date: 2014-11-12 Last modified: 2023-09-27 Method: X-RAY DIFFRACTION (2.9 Å) Cite: Gene regulation. Structural basis for microRNA targeting. Science, 346, 2014
5T7B	Argonaute-2 - 5'-(E)-vinylphosphonate 2'-O-methyl-uridine modified mrTTR guide RNA complex Descriptor: PHENOL, Protein argonaute-2, RNA (UVP)UAUAGAGCAAGAACACUGUU Authors: Elkayam, E, Joshua-Tor, L. Deposit date: 2016-09-02 Release date: 2016-12-14 Last modified: 2023-10-04 Method: X-RAY DIFFRACTION (2.529 Å) Cite: Protein structure To Be Published
5THE	Crystal structure of the C-terminal lobe of a budding yeast Argonaute Descriptor: RNA (5'-R(P*UP*AP*AP*AP*AP*AP*AP*A)-3'), Uncharacterized protein Authors: Dayeh, D.M, Nakanishi, K. Deposit date: 2016-09-29 Release date: 2018-03-14 Last modified: 2023-10-04 Method: X-RAY DIFFRACTION (2.097 Å) Cite: Structural and functional analyses reveal the contributions of the C- and N-lobes of Argonaute protein to selectivity of RNA target cleavage. J. Biol. Chem., 293, 2018
3KNC	Crystal structure of the CeNA-RNA hybrid octamer ce(GCGTAGCG):r(CGCUACGC) Descriptor: 5'-D(*(XGR)P*(XCR)P*(XGR)P*(XTR)P*(XAR)P*(XGR)P*(XCR)P*(XGR)P*(XGR))-3', 5'-R(*CP*GP*CP*UP*AP*CP*GP*C)-3', MAGNESIUM ION Authors: Ovaere, M, Van Meervelt, L. Deposit date: 2009-11-12 Release date: 2010-12-08 Last modified: 2024-02-21 Method: X-RAY DIFFRACTION (2.5 Å) Cite: The Crystal Structure of the CeNA:RNA Hybrid ce(GCGTAGCG):r(CGCUACGC). Chemistry, 17, 2011
3G7L	Chromodomain of Chp1 in complex with Histone H3K9me3 peptide Descriptor: ACETIC ACID, Chromo domain-containing protein 1, Histone H3.1/H3.2, ... Authors: Schalch, T, Joshua-Tor, L. Deposit date: 2009-02-10 Release date: 2009-04-21 Last modified: 2023-09-06 Method: X-RAY DIFFRACTION (2.2 Å) Cite: High-affinity binding of Chp1 chromodomain to K9 methylated histone H3 is required to establish centromeric heterochromatin Mol.Cell, 34, 2009
4Z4F	Human Argonaute2 Bound to t1-DAP Target RNA Descriptor: MAGNESIUM ION, PHENOL, Protein argonaute-2, ... Authors: Schirle, N.T, MacRae, I.J. Deposit date: 2015-04-02 Release date: 2015-09-23 Last modified: 2023-09-27 Method: X-RAY DIFFRACTION (2.8 Å) Cite: Water-mediated recognition of t1-adenosine anchors Argonaute2 to microRNA targets. Elife, 4, 2015
4Z4D	Human Argonaute2 Bound to t1-G Target RNA Descriptor: ISOPROPYL ALCOHOL, MAGNESIUM ION, PHENOL, ... Authors: Schirle, N.T, MacRae, I.J. Deposit date: 2015-04-02 Release date: 2015-09-23 Last modified: 2023-09-27 Method: X-RAY DIFFRACTION (1.6 Å) Cite: Water-mediated recognition of t1-adenosine anchors Argonaute2 to microRNA targets. Elife, 4, 2015
4Z4C	Human Argonaute2 Bound to t1-C Target RNA Descriptor: ISOPROPYL ALCOHOL, MAGNESIUM ION, PHENOL, ... Authors: Schirle, N.T, MacRae, I.J. Deposit date: 2015-04-02 Release date: 2015-09-23 Last modified: 2024-03-06 Method: X-RAY DIFFRACTION (2.303 Å) Cite: Water-mediated recognition of t1-adenosine anchors Argonaute2 to microRNA targets. Elife, 4, 2015
4Z4E	Human Argonaute2 Bound to t1-U Target RNA Descriptor: ISOPROPYL ALCOHOL, MAGNESIUM ION, PHENOL, ... Authors: Schirle, N.T, MacRae, I.J. Deposit date: 2015-04-02 Release date: 2015-09-23 Last modified: 2023-09-27 Method: X-RAY DIFFRACTION (1.8 Å) Cite: Water-mediated recognition of t1-adenosine anchors Argonaute2 to microRNA targets. Elife, 4, 2015
4Z4G	Human Argonaute2 Bound to t1-Inosine Target RNA Descriptor: MAGNESIUM ION, PHENOL, Protein argonaute-2, ... Authors: Schirle, N.T, MacRae, I.J. Deposit date: 2015-04-02 Release date: 2015-09-23 Last modified: 2023-09-27 Method: X-RAY DIFFRACTION (2.7 Å) Cite: Water-mediated recognition of t1-adenosine anchors Argonaute2 to microRNA targets. Elife, 4, 2015
4Z4H	Human Argonaute2 A481T Mutant Bound to t1-A Target RNA Descriptor: MAGNESIUM ION, PHENOL, Protein argonaute-2, ... Authors: Schirle, N.T, MacRae, I.J. Deposit date: 2015-04-02 Release date: 2015-09-23 Last modified: 2023-09-27 Method: X-RAY DIFFRACTION (2.504 Å) Cite: Water-mediated recognition of t1-adenosine anchors Argonaute2 to microRNA targets. Elife, 4, 2015
4Z4I	Human Argonaute2 A481T Mutant Bound to t1-G Target RNA Descriptor: MAGNESIUM ION, PHENOL, Protein argonaute-2, ... Authors: Schirle, N.T, MacRae, I.J. Deposit date: 2015-04-02 Release date: 2015-09-23 Last modified: 2023-09-27 Method: X-RAY DIFFRACTION (2.801 Å) Cite: Water-mediated recognition of t1-adenosine anchors Argonaute2 to microRNA targets. Elife, 4, 2015
1R6Z	The Crystal Structure of the Argonaute2 PAZ domain (as a MBP fusion) Descriptor: Chimera of Maltose-binding periplasmic protein and Argonaute 2, NICKEL (II) ION, alpha-D-glucopyranose-(1-4)-alpha-D-glucopyranose Authors: Song, J.J, Liu, J, Tolia, N.H, Schneiderman, J, Smith, S.K, Martienssen, R.A, Hannon, G.J, Joshua-Tor, L. Deposit date: 2003-10-17 Release date: 2004-01-13 Last modified: 2023-08-23 Method: X-RAY DIFFRACTION (2.8 Å) Cite: The crystal structure of the Argonaute2 PAZ domain reveals an RNA binding motif in RNAi effector complexes. Nat.Struct.Biol., 10, 2003
8HYJ	A cryo-EM structure of KTF1-bound polymerase V transcription elongation complex Descriptor: DNA (48-MER), DNA-directed RNA polymerase V subunit 1, DNA-directed RNA polymerase V subunit 5A, ... Authors: Zhang, H, Zhang, Y. Deposit date: 2023-01-06 Release date: 2023-06-21 Method: ELECTRON MICROSCOPY (4.3 Å) Cite: A cryo-EM structure of KTF1-bound polymerase V transcription elongation complex. Nat Commun, 14, 2023
6MDZ	Human Argonaute2-miR-122 bound to a target RNA with two central mismatches (bu2) Descriptor: PHENOL, Protein argonaute-2, RNA (5'-R(P*AP*AP*AP*CP*AP*CP*CP*AP*UP*UP*UP*CP*CP*AP*CP*AP*CP*UP*CP*CP*AP*AP*A)-3'), ... Authors: Sheu-Gruttadauria, J, MacRae, I.J. Deposit date: 2018-09-05 Release date: 2019-08-07 Last modified: 2023-10-11 Method: X-RAY DIFFRACTION (3.4 Å) Cite: Structural Basis for Target-Directed MicroRNA Degradation. Mol.Cell, 75, 2019
6MFN	Human Argonaute2-miR-27a bound to HSUR1 target RNA Descriptor: PHENOL, Protein argonaute-2, RNA (5'-R(P*UP*CP*UP*GP*UP*GP*AP*UP*AP*A)-3'), ... Authors: Sheu-Gruttadauria, J, MacRae, I.J. Deposit date: 2018-09-11 Release date: 2019-08-07 Last modified: 2023-10-11 Method: X-RAY DIFFRACTION (2.5 Å) Cite: Structural Basis for Target-Directed MicroRNA Degradation. Mol.Cell, 75, 2019
6MFR	Human Argonaute2-miR-122 bound to a target RNA with three central mismatches (bu3) Descriptor: PHENOL, PHOSPHATE ION, Protein argonaute-2, ... Authors: Sheu-Gruttadauria, J, MacRae, I.J. Deposit date: 2018-09-12 Release date: 2019-08-07 Last modified: 2023-10-11 Method: X-RAY DIFFRACTION (3.6 Å) Cite: Structural Basis for Target-Directed MicroRNA Degradation. Mol.Cell, 75, 2019

<67891011121314151617181920>