1FG0
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 1fg0 by Molmil](/molmil-images/mine/1fg0) | LARGE RIBOSOMAL SUBUNIT COMPLEXED WITH A 13 BP MINIHELIX-PUROMYCIN COMPOUND | Descriptor: | 23S RIBOSOMAL RNA, 5'-R(CCGGCGGGCUGGUUCAAACCGGCCCGCCGGACC)-3'-5'-R(P-PUROMYCIN)-3' | Authors: | Nissen, P, Hansen, J, Ban, N, Moore, P.B, Steitz, T.A. | Deposit date: | 2000-07-26 | Release date: | 2000-08-28 | Last modified: | 2024-02-07 | Method: | X-RAY DIFFRACTION (3 Å) | Cite: | The structural basis of ribosome activity in peptide bond synthesis. Science, 289, 2000
|
|
1FQ3
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 1fq3 by Molmil](/molmil-images/mine/1fq3) | CRYSTAL STRUCTURE OF HUMAN GRANZYME B | Descriptor: | GRANZYME B, SULFATE ION, beta-D-mannopyranose-(1-4)-2-acetamido-2-deoxy-beta-D-glucopyranose-(1-4)-2-acetamido-2-deoxy-beta-D-glucopyranose | Authors: | Estebanez-Perpina, E, Fuentes-Prior, P, Belorgey, D, Rubin, H, Bode, W. | Deposit date: | 2000-09-03 | Release date: | 2001-01-31 | Last modified: | 2024-04-03 | Method: | X-RAY DIFFRACTION (3.1 Å) | Cite: | Crystal structure of the caspase activator human granzyme B, a proteinase highly specific for an Asp-P1 residue. Biol.Chem., 381, 2000
|
|
1FFZ
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 1ffz by Molmil](/molmil-images/mine/1ffz) | LARGE RIBOSOMAL SUBUNIT COMPLEXED WITH R(CC)-DA-PUROMYCIN | Descriptor: | 23S RIBOSOMAL RNA, R(P*CP*C*)-D(P*A)-R(P*(PU)) | Authors: | Nissen, P, Hansen, J, Ban, N, Moore, P.B, Steitz, T.A. | Deposit date: | 2000-07-26 | Release date: | 2000-08-28 | Last modified: | 2024-02-07 | Method: | X-RAY DIFFRACTION (3.2 Å) | Cite: | The structural basis of ribosome activity in peptide bond synthesis. Science, 289, 2000
|
|
7ARA
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 7ara by Molmil](/molmil-images/mine/7ara) | Rhinovirus A2 2A protease in complex with zVAM.fmk | Descriptor: | (phenylmethyl) ~{N}-[(2~{R})-3-methyl-1-[[(2~{S})-1-[[(3~{S})-1-methylsulfanyl-4-oxidanylidene-pentan-3-yl]amino]-1-oxidanylidene-propan-2-yl]amino]-1-oxidanylidene-butan-2-yl]carbamate, (phenylmethyl) ~{N}-[(2~{S})-3-methyl-1-[[(2~{R})-1-[[(3~{R})-1-methylsulfanyl-4-oxidanylidene-pentan-3-yl]amino]-1-oxidanylidene-propan-2-yl]amino]-1-oxidanylidene-butan-2-yl]carbamate, 2A protease, ... | Authors: | Deutschmann-Olek, K.M, Skern, T, Bezerra, G.A, Yue, W.W. | Deposit date: | 2020-10-23 | Release date: | 2021-07-28 | Last modified: | 2024-01-31 | Method: | X-RAY DIFFRACTION (2.243 Å) | Cite: | Defining substrate selection by rhinoviral 2A proteinase through its crystal structure with the inhibitor zVAM.fmk. Virology, 562, 2021
|
|
1GVZ
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 1gvz by Molmil](/molmil-images/mine/1gvz) | Prostate Specific Antigen (PSA) from stallion seminal plasma | Descriptor: | ACETATE ION, GLYCEROL, KALLIKREIN-1E2 | Authors: | Carvalho, A.L, Sanz, L, Barettino, D, Romero, A, Calvete, J.J, Romao, M.J. | Deposit date: | 2002-02-28 | Release date: | 2002-09-12 | Last modified: | 2011-09-21 | Method: | X-RAY DIFFRACTION (1.42 Å) | Cite: | Crystal Structure of a Prostate Kallikrein Isolated from Stallion Seminal Plasma: A Homologue of Human Psa J.Mol.Biol., 322, 2002
|
|
8QFY
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 8qfy by Molmil](/molmil-images/mine/8qfy) | |
5BPX
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 5bpx by Molmil](/molmil-images/mine/5bpx) | Structure of the 2,4'-dihydroxyacetophenone dioxygenase from Alcaligenes sp. 4HAP. | Descriptor: | 2,4'-dihydroxyacetophenone dioxygenase, ACETATE ION, FE (III) ION, ... | Authors: | Guo, J, Erskine, P, Wood, S.P, Cooper, J.B. | Deposit date: | 2015-05-28 | Release date: | 2015-06-10 | Last modified: | 2024-01-10 | Method: | X-RAY DIFFRACTION (1.88 Å) | Cite: | Extension of resolution and oligomerization-state studies of 2,4'-dihydroxyacetophenone dioxygenase from Alcaligenes sp. 4HAP. Acta Crystallogr.,Sect.F, 71, 2015
|
|
7OFH
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 7ofh by Molmil](/molmil-images/mine/7ofh) | |
5C7M
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 5c7m by Molmil](/molmil-images/mine/5c7m) | CRYSTAL STRUCTURE OF E3 LIGASE ITCH WITH A UB VARIANT | Descriptor: | E3 ubiquitin-protein ligase Itchy homolog, Polyubiquitin-C | Authors: | Walker, J.R, Hu, J, Dong, A, Wernimont, A, Zhang, W, Sidhu, S, Bountra, C, Edwards, A.M, Arrowsmith, C.H, Tong, Y, Structural Genomics Consortium (SGC) | Deposit date: | 2015-06-24 | Release date: | 2016-03-16 | Last modified: | 2023-09-27 | Method: | X-RAY DIFFRACTION (3.03 Å) | Cite: | System-Wide Modulation of HECT E3 Ligases with Selective Ubiquitin Variant Probes. Mol.Cell, 62, 2016
|
|
4E0R
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 4e0r by Molmil](/molmil-images/mine/4e0r) | Structure of the chicken MHC class I molecule BF2*0401 | Descriptor: | 8-MERIC PEPTIDE (FUS/TLS), Beta-2 microglobulin, MHC class I alpha chain 2 | Authors: | Zhang, J, Chen, Y, Qi, J, Gao, F, Kaufman, J, Xia, C, Gao, G.F. | Deposit date: | 2012-03-05 | Release date: | 2012-11-21 | Last modified: | 2023-11-08 | Method: | X-RAY DIFFRACTION (2.26 Å) | Cite: | Narrow Groove and Restricted Anchors of MHC Class I Molecule BF2*0401 Plus Peptide Transporter Restriction Can Explain Disease Susceptibility of B4 Chickens. J.Immunol., 189, 2012
|
|
5CP4
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 5cp4 by Molmil](/molmil-images/mine/5cp4) | CRYOGENIC STRUCTURE OF P450CAM | Descriptor: | CAMPHOR, CYTOCHROME P450CAM, GLYCEROL, ... | Authors: | Li, H, Poulos, T.L. | Deposit date: | 1998-05-28 | Release date: | 1998-09-16 | Last modified: | 2024-05-22 | Method: | X-RAY DIFFRACTION (1.75 Å) | Cite: | Understanding the role of the essential Asp251 in cytochrome p450cam using site-directed mutagenesis, crystallography, and kinetic solvent isotope effect. Biochemistry, 37, 1998
|
|
4LK4
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 4lk4 by Molmil](/molmil-images/mine/4lk4) | |
4MCS
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 4mcs by Molmil](/molmil-images/mine/4mcs) | A high resolution structure of human glutamate carboxypeptidase II (GCPII) His475Tyr variant in complex with glutamic acid | Descriptor: | 2-acetamido-2-deoxy-beta-D-glucopyranose, 2-acetamido-2-deoxy-beta-D-glucopyranose-(1-4)-2-acetamido-2-deoxy-beta-D-glucopyranose, ASPARTIC ACID, ... | Authors: | Ptacek, J, Barinka, C, Sacha, P, Navratil, M. | Deposit date: | 2013-08-21 | Release date: | 2014-06-18 | Last modified: | 2020-07-29 | Method: | X-RAY DIFFRACTION (1.83 Å) | Cite: | Structural and biochemical characterization of the folyl-poly-gamma-l-glutamate hydrolyzing activity of human glutamate carboxypeptidase II. Febs J., 281, 2014
|
|
4JQV
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 4jqv by Molmil](/molmil-images/mine/4jqv) | HLA-B*18:01 in complex with Epstein-Barr virus BZLF1-derived peptide (residues 173-180) | Descriptor: | ACETATE ION, Beta-2-microglobulin, HLA class I histocompatibility antigen, ... | Authors: | Theodossis, A, Welland, A, Gras, S, Rossjohn, J. | Deposit date: | 2013-03-20 | Release date: | 2013-06-26 | Last modified: | 2023-09-20 | Method: | X-RAY DIFFRACTION (1.5 Å) | Cite: | HLA Peptide Length Preferences Control CD8+ T Cell Responses. J.Immunol., 191, 2013
|
|
5AHJ
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 5ahj by Molmil](/molmil-images/mine/5ahj) | Yeast 20S proteasome in complex with Macyranone A | Descriptor: | 2-(N-MORPHOLINO)-ETHANESULFONIC ACID, 20S PROTEASOME, CHLORIDE ION, ... | Authors: | Etzbach, L, Plaza, A, Dubiella, C, Groll, M, Kaiser, M, Mueller, R. | Deposit date: | 2015-02-06 | Release date: | 2015-02-18 | Last modified: | 2024-01-10 | Method: | X-RAY DIFFRACTION (2.8 Å) | Cite: | Macyranones: Structure, Biosynthesis, and Binding Mode of an Unprecedented Epoxyketone that Targets the 20S Proteasome. J.Am.Chem.Soc., 137, 2015
|
|
4MCP
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 4mcp by Molmil](/molmil-images/mine/4mcp) | A high resolution structure of human glutamate carboxypeptidase II (GCPII) in complex with folyl-gamma-L-glutamic acid (pteroyldi-gamma-L-glutamic acid) | Descriptor: | 2-acetamido-2-deoxy-beta-D-glucopyranose, 2-acetamido-2-deoxy-beta-D-glucopyranose-(1-4)-2-acetamido-2-deoxy-beta-D-glucopyranose, CALCIUM ION, ... | Authors: | Navratil, M, Barinka, C, Lubkowski, J. | Deposit date: | 2013-08-21 | Release date: | 2014-06-18 | Last modified: | 2020-07-29 | Method: | X-RAY DIFFRACTION (1.65 Å) | Cite: | Structural and biochemical characterization of the folyl-poly-gamma-l-glutamate hydrolyzing activity of human glutamate carboxypeptidase II. Febs J., 281, 2014
|
|
4JQX
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 4jqx by Molmil](/molmil-images/mine/4jqx) | HLA-B*44:03 in complex with Epstein-Barr virus BZLF1-derived peptide (residues 169-180) | Descriptor: | ACETATE ION, Beta-2-microglobulin, GLYCEROL, ... | Authors: | Theodossis, A, Welland, A, Gras, S, Rossjohn, J. | Deposit date: | 2013-03-20 | Release date: | 2013-06-26 | Last modified: | 2023-09-20 | Method: | X-RAY DIFFRACTION (1.9 Å) | Cite: | HLA Peptide Length Preferences Control CD8+ T Cell Responses. J.Immunol., 191, 2013
|
|
4TPI
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 4tpi by Molmil](/molmil-images/mine/4tpi) | THE REFINED 2.2-ANGSTROMS (0.22-NM) X-RAY CRYSTAL STRUCTURE OF THE TERNARY COMPLEX FORMED BY BOVINE TRYPSINOGEN, VALINE-VALINE AND THE ARG15 ANALOGUE OF BOVINE PANCREATIC TRYPSIN INHIBITOR | Descriptor: | BOVINE PANCREATIC TRYPSIN INHIBITOR, CALCIUM ION, SULFATE ION, ... | Authors: | Bode, W, Walter, J. | Deposit date: | 1985-06-11 | Release date: | 1985-11-08 | Last modified: | 2024-06-05 | Method: | X-RAY DIFFRACTION (2.2 Å) | Cite: | The refined 2.2-A (0.22-nm) X-ray crystal structure of the ternary complex formed by bovine trypsinogen, valine-valine and the Arg15 analogue of bovine pancreatic trypsin inhibitor Eur.J.Biochem., 144, 1984
|
|
4U13
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 4u13 by Molmil](/molmil-images/mine/4u13) | Crystal structure of putative polyketide cyclase (protein SMa1630) from Sinorhizobium meliloti at 2.3 A resolution | Descriptor: | putative polyketide cyclase SMa1630 | Authors: | Shabalin, I.G, Bacal, P, Osinski, T, Cooper, D.R, Szlachta, K, Stead, M, Grabowski, M, Hammonds, J, Ahmed, M, Hillerich, B.S, Bonanno, J, Seidel, R, Almo, S.C, Minor, W, New York Structural Genomics Research Consortium (NYSGRC) | Deposit date: | 2014-07-14 | Release date: | 2014-09-10 | Last modified: | 2023-11-15 | Method: | X-RAY DIFFRACTION (2.3 Å) | Cite: | Crystal structure of a putative polyketide cyclase (protein SMa1630) from Sinorhizobium meliloti at 2.3 A resolution to be published
|
|
4MCQ
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 4mcq by Molmil](/molmil-images/mine/4mcq) | |
5BON
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 5bon by Molmil](/molmil-images/mine/5bon) | Crystal structure of human Nudt15 (MTH2) | Descriptor: | MAGNESIUM ION, Probable 8-oxo-dGTP diphosphatase NUDT15 | Authors: | Carter, M, Jemth, A.-S, Helleday, T, Stenmark, P. | Deposit date: | 2015-05-27 | Release date: | 2015-08-05 | Last modified: | 2024-01-10 | Method: | X-RAY DIFFRACTION (1.799 Å) | Cite: | Crystal structure, biochemical and cellular activities demonstrate separate functions of MTH1 and MTH2. Nat Commun, 6, 2015
|
|
4GSN
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 4gsn by Molmil](/molmil-images/mine/4gsn) | |
1SGT
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 1sgt by Molmil](/molmil-images/mine/1sgt) | |
1RYP
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 1ryp by Molmil](/molmil-images/mine/1ryp) | CRYSTAL STRUCTURE OF THE 20S PROTEASOME FROM YEAST AT 2.4 ANGSTROMS RESOLUTION | Descriptor: | 20S PROTEASOME, MAGNESIUM ION | Authors: | Groll, M, Ditzel, L, Loewe, J, Stock, D, Bochtler, M, Bartunik, H.D, Huber, R. | Deposit date: | 1997-02-26 | Release date: | 1998-04-15 | Last modified: | 2024-05-22 | Method: | X-RAY DIFFRACTION (1.9 Å) | Cite: | Structure of 20S proteasome from yeast at 2.4 A resolution. Nature, 386, 1997
|
|
4MCR
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 4mcr by Molmil](/molmil-images/mine/4mcr) | A high resolution structure of human glutamate carboxypeptidase II (GCPII) in complex with folyltri-gamma-L-glutamic acid (pteroyltetra-gamma-L-glutamic acid) | Descriptor: | 2-acetamido-2-deoxy-beta-D-glucopyranose, 2-acetamido-2-deoxy-beta-D-glucopyranose-(1-4)-2-acetamido-2-deoxy-beta-D-glucopyranose, CALCIUM ION, ... | Authors: | Navratil, M, Barinka, C, Lubkowski, J. | Deposit date: | 2013-08-21 | Release date: | 2014-06-18 | Last modified: | 2020-07-29 | Method: | X-RAY DIFFRACTION (1.65 Å) | Cite: | Structural and biochemical characterization of the folyl-poly-gamma-l-glutamate hydrolyzing activity of human glutamate carboxypeptidase II. Febs J., 281, 2014
|
|