2HUE
 
 | | Structure of the H3-H4 chaperone Asf1 bound to histones H3 and H4 | | Descriptor: | Anti-silencing protein 1, GLYCEROL, Histone H3, ... | | Authors: | English, C.M, Churchill, M.E.A, Tyler, J.K. | | Deposit date: | 2006-07-26 | | Release date: | 2006-11-21 | | Last modified: | 2024-02-14 | | Method: | X-RAY DIFFRACTION (1.7 Å) | | Cite: | Structural basis for the histone chaperone activity of asf1.
Cell(Cambridge,Mass.), 127, 2006
|
|
1KX5
 | | X-Ray Structure of the Nucleosome Core Particle, NCP147, at 1.9 A Resolution | | Descriptor: | CHLORIDE ION, DNA (5'(ATCAATATCCACCTGCAGATACTACCAAAAGTGTATTTGGAAACTGCTCCATCAAAAGGCATGTTCAGCTGGAATCCAGCTGAACATGCCTTTTGATGGAGCAGTTTCCAAATACACTTTTGGTAGTATCTGCAGGTGGATATTGAT)3'), DNA (5'(ATCAATATCCACCTGCAGATACTACCAAAAGTGTATTTGGAAACTGCTCCATCAAAAGGCATGTTCAGCTGGATTCCAGCTGAACATGCCTTTTGATGGAGCAGTTTCCAAATACACTTTTGGTAGTATCTGCAGGTGGATATTGAT)3'), ... | | Authors: | Davey, C.A, Sargent, D.F, Luger, K, Maeder, A.W, Richmond, T.J. | | Deposit date: | 2002-01-31 | | Release date: | 2002-12-25 | | Last modified: | 2023-08-16 | | Method: | X-RAY DIFFRACTION (1.94 Å) | | Cite: | Solvent Mediated Interactions in the Structure of the Nucleosome Core Particle at 1.9 A Resolution
J.Mol.Biol., 319, 2002
|
|
1KX3
 | | X-Ray Structure of the Nucleosome Core Particle, NCP146, at 2.0 A Resolution | | Descriptor: | DNA (5'(ATCAATATCCACCTGCAGATTCTACCAAAAGTGTATTTGGAAACTGCTCCATCAAAAGGCATGTTCAGCTGAATTCAGCTGAACATGCCTTTTGATGGAGCAGTTTCCAAATACACTTTTGGTAGAATCTGCAGGTGGATATTGAT)3'), MANGANESE (II) ION, histone H2A.1, ... | | Authors: | Davey, C.A, Sargent, D.F, Luger, K, Maeder, A.W, Richmond, T.J. | | Deposit date: | 2002-01-31 | | Release date: | 2002-12-25 | | Last modified: | 2023-08-16 | | Method: | X-RAY DIFFRACTION (2 Å) | | Cite: | Solvent Mediated Interactions in the Structure of the Nucleosome Core Particle at 1.9 A Resolution
J.Mol.Biol., 319, 2002
|
|
1S32
 | | Molecular Recognition of the Nucleosomal 'Supergroove' | | Descriptor: | 2-(2-CARBAMOYLMETHOXY-ETHOXY)-ACETAMIDE, 3-AMINO-(DIMETHYLPROPYLAMINE), 4-AMINO-(1-METHYLIMIDAZOLE)-2-CARBOXYLIC ACID, ... | | Authors: | Edayathumangalam, R.S, Weyermann, P, Gottesfeld, J.M, Dervan, P.B, Luger, K. | | Deposit date: | 2004-01-12 | | Release date: | 2004-05-11 | | Last modified: | 2023-11-15 | | Method: | X-RAY DIFFRACTION (2.05 Å) | | Cite: | Molecular Recognition of the Nucleosomal 'Supergroove'
Proc.Natl.Acad.Sci.USA, 101, 2004
|
|
3UTA
 | | Crystal Structure of Nucleosome Core Particle Assembled with an Alpha-Satellite Sequence Containing Two TTAAA elements (NCP-TA2) | | Descriptor: | 145-mer DNA, CHLORIDE ION, Histone H2A, ... | | Authors: | Chua, E.Y.D, Vasudevan, D, Davey, G.E, Wu, B, Davey, C.A. | | Deposit date: | 2011-11-25 | | Release date: | 2012-04-11 | | Last modified: | 2024-03-20 | | Method: | X-RAY DIFFRACTION (2.07 Å) | | Cite: | The mechanics behind DNA sequence-dependent properties of the nucleosome
Nucleic Acids Res., 40, 2012
|
|
3C1B
 | | The effect of H3 K79 dimethylation and H4 K20 trimethylation on nucleosome and chromatin structure | | Descriptor: | Histone 2, H2bf, Histone H2A type 1, ... | | Authors: | Lu, X, Simon, M, Chodaparambil, J, Hansen, J, Shokat, K, Luger, K. | | Deposit date: | 2008-01-22 | | Release date: | 2008-10-07 | | Last modified: | 2023-11-15 | | Method: | X-RAY DIFFRACTION (2.2 Å) | | Cite: | The effect of H3K79 dimethylation and H4K20 trimethylation on nucleosome and chromatin structure.
Nat.Struct.Mol.Biol., 15, 2008
|
|
3UT9
 | | Crystal Structure of Nucleosome Core Particle Assembled with a Palindromic Widom '601' Derivative (NCP-601L) | | Descriptor: | 145-mer DNA, CHLORIDE ION, Histone H2A, ... | | Authors: | Chua, E.Y.D, Vasudevan, D, Davey, G.E, Wu, B, Davey, C.A. | | Deposit date: | 2011-11-25 | | Release date: | 2012-04-11 | | Last modified: | 2024-03-20 | | Method: | X-RAY DIFFRACTION (2.2 Å) | | Cite: | The mechanics behind DNA sequence-dependent properties of the nucleosome
Nucleic Acids Res., 40, 2012
|
|
3UTB
 | | Crystal Structure of Nucleosome Core Particle Assembled with the 146b Alpha-Satellite Sequence (NCP146b) | | Descriptor: | 146-mer DNA, Histone H2A, Histone H2B 1.1, ... | | Authors: | Chua, E.Y.D, Vasudevan, D, Davey, G.E, Wu, B, Davey, C.A. | | Deposit date: | 2011-11-25 | | Release date: | 2012-04-11 | | Last modified: | 2024-03-20 | | Method: | X-RAY DIFFRACTION (2.2 Å) | | Cite: | The mechanics behind DNA sequence-dependent properties of the nucleosome
Nucleic Acids Res., 40, 2012
|
|
6WZ5
 | |
4ZBJ
 | | UBN1 peptide bound to H3.3/H4/Asf1 | | Descriptor: | (4S)-2-METHYL-2,4-PENTANEDIOL, CHLORIDE ION, Histone H3, ... | | Authors: | Marmorstein, R, Ricketts, M.D, Tang, Y. | | Deposit date: | 2015-04-14 | | Release date: | 2015-07-15 | | Last modified: | 2023-09-27 | | Method: | X-RAY DIFFRACTION (2.248 Å) | | Cite: | Ubinuclein-1 confers histone H3.3-specific-binding by the HIRA histone chaperone complex.
Nat Commun, 6, 2015
|
|
7TN2
 | | Composite model of a Chd1-nucleosome complex in the nucleotide-free state derived from 2.3A and 2.7A Cryo-EM maps | | Descriptor: | Chromo domain-containing protein 1, DNA Lagging Strand, DNA Tracking Strand, ... | | Authors: | Nodelman, I.M, Bowman, G.D, Armache, J.-P. | | Deposit date: | 2022-01-20 | | Release date: | 2022-03-02 | | Last modified: | 2024-02-21 | | Method: | ELECTRON MICROSCOPY (2.3 Å) | | Cite: | Nucleosome recognition and DNA distortion by the Chd1 remodeler in a nucleotide-free state.
Nat.Struct.Mol.Biol., 29, 2022
|
|
8G86
 | | Human Oct4 bound to nucleosome with human nMatn1 sequence (focused refinement of nucleosome) | | Descriptor: | Histone H2A, Histone H2B, Histone H3, ... | | Authors: | Sinha, K.K, Bilokapic, S, Du, Y, Malik, D, Halic, M. | | Deposit date: | 2023-02-17 | | Release date: | 2023-03-22 | | Last modified: | 2023-07-26 | | Method: | ELECTRON MICROSCOPY (2.3 Å) | | Cite: | Histone modifications regulate pioneer transcription factor cooperativity.
Nature, 619, 2023
|
|
8G88
 | | Human Oct4 bound to nucleosome with human nMatn1 sequence | | Descriptor: | Histone H2A, Histone H2B, Histone H3, ... | | Authors: | Sinha, K.K, Bilokapic, S, Du, Y, Malik, D, Halic, M. | | Deposit date: | 2023-02-17 | | Release date: | 2023-03-22 | | Last modified: | 2023-07-26 | | Method: | ELECTRON MICROSCOPY (2.3 Å) | | Cite: | Histone modifications regulate pioneer transcription factor cooperativity.
Nature, 619, 2023
|
|
1P3I
 | | Crystallographic Studies of Nucleosome Core Particles containing Histone 'Sin' Mutants | | Descriptor: | Histone H2A, Histone H2B, Histone H3, ... | | Authors: | Muthurajan, U.M, Bao, Y, Forsberg, L.J, Edayathumangalam, R.S, Dyer, P.N, White, C.L, Luger, K. | | Deposit date: | 2003-04-17 | | Release date: | 2004-02-24 | | Last modified: | 2023-08-16 | | Method: | X-RAY DIFFRACTION (2.3 Å) | | Cite: | Crystal structures of histone Sin mutant nucleosomes reveal altered protein-DNA interactions
EMBO J., 23, 2004
|
|
3MGR
 | | Binding of Rubidium ions to the Nucleosome Core Particle | | Descriptor: | CHLORIDE ION, DNA (147-MER), Histone H2A, ... | | Authors: | Mohideen, K, Muhammad, R, Davey, C.A. | | Deposit date: | 2010-04-07 | | Release date: | 2010-06-16 | | Last modified: | 2023-11-01 | | Method: | X-RAY DIFFRACTION (2.3 Å) | | Cite: | Perturbations in nucleosome structure from heavy metal association.
Nucleic Acids Res., 38, 2010
|
|
1M19
 | | LIGAND BINDING ALTERS THE STRUCTURE AND DYNAMICS OF NUCLEOSOMAL DNA | | Descriptor: | 3-AMINO-(DIMETHYLPROPYLAMINE), 4-AMINO-(1-METHYLIMIDAZOLE)-2-CARBOXYLIC ACID, 4-AMINO-(1-METHYLPYRROLE)-2-CARBOXYLIC ACID, ... | | Authors: | Suto, R.K, Edayathumangalam, R.S, White, C.L, Melander, C, Gottesfeld, J.M, Dervan, P.B, Luger, K. | | Deposit date: | 2002-06-18 | | Release date: | 2003-02-18 | | Last modified: | 2023-11-15 | | Method: | X-RAY DIFFRACTION (2.3 Å) | | Cite: | Crystal Structures of Nucleosome Core Particles in Complex with Minor Groove DNA-binding Ligands
J.Mol.Biol., 326, 2003
|
|
5OMX
 | |
6YN1
 | | Crystal structure of histone chaperone APLF acidic domain bound to the histone H2A-H2B-H3-H4 octamer | | Descriptor: | Aprataxin and PNK-like factor, CHLORIDE ION, GLYCEROL, ... | | Authors: | Corbeski, I, Guo, X, Van Ingen, H, Sixma, T.K. | | Deposit date: | 2020-04-10 | | Release date: | 2021-11-17 | | Last modified: | 2024-01-24 | | Method: | X-RAY DIFFRACTION (2.35 Å) | | Cite: | Chaperoning of the histone octamer by the acidic domain of DNA repair factor APLF.
Sci Adv, 8, 2022
|
|
4EO5
 | | Yeast Asf1 bound to H3/H4G94P mutant | | Descriptor: | ACETATE ION, GLYCEROL, Histone H3.2, ... | | Authors: | Scorgie, J.K, Churchill, M.E. | | Deposit date: | 2012-04-13 | | Release date: | 2012-06-13 | | Last modified: | 2023-09-13 | | Method: | X-RAY DIFFRACTION (2.35 Å) | | Cite: | The conformational flexibility of the C-terminus of histone H4 promotes histone octamer and nucleosome stability and yeast viability.
Epigenetics Chromatin, 5, 2012
|
|
4J8U
 | |
1P3L
 | | Crystallographic Studies of Nucleosome Core Particles containing Histone 'Sin' Mutants | | Descriptor: | Histone H2A, Histone H2B, Histone H3, ... | | Authors: | Muthurajan, U.M, Bao, Y, Forsberg, L.J, Edayathumangalam, R.S, Dyer, P.N, White, C.L, Luger, K. | | Deposit date: | 2003-04-17 | | Release date: | 2004-02-24 | | Last modified: | 2023-08-16 | | Method: | X-RAY DIFFRACTION (2.4 Å) | | Cite: | Crystal structures of histone Sin mutant nucleosomes reveal altered protein-DNA interactions
EMBO J., 23, 2004
|
|
4XZQ
 | | Nucleosome disassembly by RSC and SWI/SNF is enhanced by H3 acetylation near the nucleosome dyad axis | | Descriptor: | DNA (147-MER), Histone H2A, Histone H2B 1.1, ... | | Authors: | Dechassa, M.L, Luger, K, Chatterjee, N, North, J.A, Manohar, M, Prasad, R, Ottessen, J.J, Poirier, M.G, Bartholomew, B. | | Deposit date: | 2015-02-04 | | Release date: | 2015-10-14 | | Last modified: | 2023-11-15 | | Method: | X-RAY DIFFRACTION (2.4 Å) | | Cite: | Histone Acetylation near the Nucleosome Dyad Axis Enhances Nucleosome Disassembly by RSC and SWI/SNF.
Mol.Cell.Biol., 35, 2015
|
|
4J8W
 | |
3MGP
 | | Binding of Cobalt ions to the Nucleosome Core Particle | | Descriptor: | CHLORIDE ION, COBALT (II) ION, DNA (147-MER), ... | | Authors: | Mohideen, K, Muhammad, R, Davey, C.A. | | Deposit date: | 2010-04-07 | | Release date: | 2010-06-16 | | Last modified: | 2023-11-01 | | Method: | X-RAY DIFFRACTION (2.44 Å) | | Cite: | Perturbations in nucleosome structure from heavy metal association.
Nucleic Acids Res., 38, 2010
|
|
4WU8
 | | Structure of trPtNAP-NCP145 | | Descriptor: | DNA (145-MER), Histone H2A type 1, Histone H2B 1.1, ... | | Authors: | Chua, E.Y.D, Davey, C.A. | | Deposit date: | 2014-10-31 | | Release date: | 2015-09-02 | | Last modified: | 2024-03-20 | | Method: | X-RAY DIFFRACTION (2.45 Å) | | Cite: | Stereochemical control of nucleosome targeting by platinum-intercalator antitumor agents.
Nucleic Acids Res., 43, 2015
|
|
