2BCW
| Coordinates of the N-terminal domain of ribosomal protein L11,C-terminal domain of ribosomal protein L7/L12 and a portion of the G' domain of elongation factor G, as fitted into cryo-em map of an Escherichia coli 70S*EF-G*GDP*fusidic acid complex | Descriptor: | 50S ribosomal protein L11, 50S ribosomal protein L7/L12, Elongation factor G | Authors: | Datta, P.P, Sharma, M.R, Qi, L, Frank, J, Agrawal, R.K. | Deposit date: | 2005-10-19 | Release date: | 2005-12-20 | Last modified: | 2024-02-14 | Method: | ELECTRON MICROSCOPY (11.2 Å) | Cite: | Interaction of the G' Domain of Elongation Factor G and the C-Terminal Domain of Ribosomal Protein L7/L12 during Translocation as Revealed by Cryo-EM. Mol.Cell, 20, 2005
|
|
1K9M
| Co-crystal structure of tylosin bound to the 50S ribosomal subunit of Haloarcula marismortui | Descriptor: | 23S RRNA, 5S RRNA, CADMIUM ION, ... | Authors: | Hansen, J.L, Ippolito, J.A, Ban, N, Nissen, P, Moore, P.B, Steitz, T.A. | Deposit date: | 2001-10-29 | Release date: | 2002-07-19 | Last modified: | 2023-08-16 | Method: | X-RAY DIFFRACTION (3 Å) | Cite: | The structures of four macrolide antibiotics bound to the large ribosomal subunit. Mol.Cell, 10, 2002
|
|
4BSZ
| |
1KD1
| Co-crystal Structure of Spiramycin bound to the 50S Ribosomal Subunit of Haloarcula marismortui | Descriptor: | 23S RRNA, 5S RRNA, CADMIUM ION, ... | Authors: | Hansen, J.L, Ippolito, J.A, Ban, N, Nissen, P, Moore, P.B, Steitz, T.A. | Deposit date: | 2001-11-12 | Release date: | 2002-07-19 | Last modified: | 2023-08-16 | Method: | X-RAY DIFFRACTION (3 Å) | Cite: | The structures of four macrolide antibiotics bound to the large ribosomal subunit. Mol.Cell, 10, 2002
|
|
1M1K
| Co-crystal structure of azithromycin bound to the 50S ribosomal subunit of Haloarcula marismortui | Descriptor: | 23S RRNA, 5S RRNA, AZITHROMYCIN, ... | Authors: | Hansen, J.L, Ippolito, J.A, Ban, N, Nissen, P, Moore, P.B, Steitz, T.A. | Deposit date: | 2002-06-19 | Release date: | 2002-07-19 | Last modified: | 2024-02-14 | Method: | X-RAY DIFFRACTION (3.2 Å) | Cite: | The structures of four macrolide antibiotics bound to the large ribosomal subunit. Mol.Cell, 10, 2002
|
|
1FG0
| LARGE RIBOSOMAL SUBUNIT COMPLEXED WITH A 13 BP MINIHELIX-PUROMYCIN COMPOUND | Descriptor: | 23S RIBOSOMAL RNA, 5'-R(CCGGCGGGCUGGUUCAAACCGGCCCGCCGGACC)-3'-5'-R(P-PUROMYCIN)-3' | Authors: | Nissen, P, Hansen, J, Ban, N, Moore, P.B, Steitz, T.A. | Deposit date: | 2000-07-26 | Release date: | 2000-08-28 | Last modified: | 2024-02-07 | Method: | X-RAY DIFFRACTION (3 Å) | Cite: | The structural basis of ribosome activity in peptide bond synthesis. Science, 289, 2000
|
|
4ZOX
| |
4V9F
| |
5TQB
| |
2QEX
| |
4BTS
| THE CRYSTAL STRUCTURE OF THE EUKARYOTIC 40S RIBOSOMAL SUBUNIT IN COMPLEX WITH EIF1 AND EIF1A | Descriptor: | 18S ribosomal RNA, 40S RIBOSOMAL PROTEIN RACK1, 40S RIBOSOMAL PROTEIN RPS10E, ... | Authors: | Weisser, M, Voigts-Hoffmann, F, Rabl, J, Leibundgut, M, Ban, N. | Deposit date: | 2013-06-19 | Release date: | 2013-07-17 | Last modified: | 2023-12-20 | Method: | X-RAY DIFFRACTION (3.703 Å) | Cite: | The crystal structure of the eukaryotic 40S ribosomal subunit in complex with eIF1 and eIF1A. Nat. Struct. Mol. Biol., 20, 2013
|
|
1QVF
| Structure of a deacylated tRNA minihelix bound to the E site of the large ribosomal subunit of Haloarcula marismortui | Descriptor: | 23S ribosomal rna, 50S RIBOSOMAL PROTEIN L10E, 50S ribosomal protein L13P, ... | Authors: | Schmeing, T.M, Moore, P.B, Steitz, T.A. | Deposit date: | 2003-08-27 | Release date: | 2003-11-11 | Last modified: | 2023-08-16 | Method: | X-RAY DIFFRACTION (3.1 Å) | Cite: | Structures of deacylated tRNA mimics bound to the E site of the large ribosomal subunit RNA, 9, 2003
|
|
1QVG
| Structure of CCA oligonucleotide bound to the tRNA binding sites of the large ribosomal subunit of Haloarcula marismortui | Descriptor: | 23S ribosomal rna, 50S RIBOSOMAL PROTEIN L10E, 50S ribosomal protein L13P, ... | Authors: | Schmeing, T.M, Moore, P.B, Steitz, T.A. | Deposit date: | 2003-08-27 | Release date: | 2003-11-11 | Last modified: | 2023-08-16 | Method: | X-RAY DIFFRACTION (2.9 Å) | Cite: | Structures of deacylated tRNA mimics bound to the E site of the large ribosomal subunit RNA, 9, 2003
|
|
1ZHO
| The structure of a ribosomal protein L1 in complex with mRNA | Descriptor: | 50S ribosomal protein L1, POTASSIUM ION, mRNA | Authors: | Nevskaya, N, Tishchenko, S, Volchkov, S, Kljashtorny, V, Nikonova, E, Nikonov, O, Nikulin, A, Kohrer, C, Piendl, W, Zimmermann, R, Stockley, P, Garber, M, Nikonov, S. | Deposit date: | 2005-04-26 | Release date: | 2006-05-09 | Last modified: | 2023-11-15 | Method: | X-RAY DIFFRACTION (2.6 Å) | Cite: | New insights into the interaction of ribosomal protein L1 with RNA. J.Mol.Biol., 355, 2006
|
|
3JCS
| 2.8 Angstrom cryo-EM structure of the large ribosomal subunit from the eukaryotic parasite Leishmania | Descriptor: | 26S alpha ribosomal RNA, 26S delta ribosomal RNA, 26S epsilon ribosomal RNA, ... | Authors: | Shalev-Benami, M, Zhang, Y, Matzov, D, Halfon, Y, Zackay, A, Rozenberg, H, Zimmerman, E, Bashan, A, Jaffe, C.L, Yonath, A, Skiniotis, G. | Deposit date: | 2016-01-21 | Release date: | 2016-07-20 | Last modified: | 2018-07-18 | Method: | ELECTRON MICROSCOPY (2.8 Å) | Cite: | 2.8- angstrom Cryo-EM Structure of the Large Ribosomal Subunit from the Eukaryotic Parasite Leishmania. Cell Rep, 16, 2016
|
|
5NRG
| The crystal structure of the large ribosomal subunit of Staphylococcus aureus in complex with RB02 | Descriptor: | (4S)-2-METHYL-2,4-PENTANEDIOL, 23S ribosomal RNA, 4-(2-HYDROXYETHYL)-1-PIPERAZINE ETHANESULFONIC ACID, ... | Authors: | Yonath, A, Matzov, D, Eyal, Z, Ben Hamou, R, Zimmerman, E, Rozenberg, H, Bashan, A, Fridman, M. | Deposit date: | 2017-04-23 | Release date: | 2017-08-09 | Last modified: | 2024-01-17 | Method: | X-RAY DIFFRACTION (3.442 Å) | Cite: | Structural insights of lincosamides targeting the ribosome of Staphylococcus aureus. Nucleic Acids Res., 45, 2017
|
|
1XBP
| Inhibition of peptide bond formation by pleuromutilins: The structure of the 50S ribosomal subunit from Deinococcus radiodurans in complex with Tiamulin | Descriptor: | 23S RIBOSOMAL RNA, 50S ribosomal protein L11, 50S ribosomal protein L13, ... | Authors: | Schluenzen, F, Pyetan, E, Fucini, P, Yonath, A, Harms, J.M. | Deposit date: | 2004-08-31 | Release date: | 2005-03-01 | Last modified: | 2023-08-23 | Method: | X-RAY DIFFRACTION (3.5 Å) | Cite: | Inhibition of peptide bond formation by pleuromutilins: the structure of the 50S ribosomal subunit from Deinococcus radiodurans in complex with tiamulin. Mol.Microbiol., 54, 2004
|
|
5NPM
| CRYSTAL STRUCTURE OF MUTANT RIBOSOMAL PROTEIN TTHL1 LACKING 8 N-TERMINAL RESIDUES IN COMPLEX WITH 80NT 23S RNA FROM THERMUS THERMOPHILUS | Descriptor: | 23S ribosomal RNA, 50S ribosomal protein L1, MALONATE ION, ... | Authors: | Gabdulkhakov, A.G, Tishchenko, T.V, Nevskaya, N.A, Nikonov, S.V, Garber, M.B. | Deposit date: | 2017-04-17 | Release date: | 2018-05-16 | Last modified: | 2024-01-17 | Method: | X-RAY DIFFRACTION (2.7 Å) | Cite: | [Influence of Nonconserved Regions of L1 Protuberance of Thermus thermophilus Ribosome on the Affinity of L1 Protein to 23s rRNA]. Mol.Biol.(Moscow), 52, 2018
|
|
8BH6
| Mature 30S ribosomal subunit from Staphylococcus aureus | Descriptor: | 16S ribosomal RNA, 30S ribosomal protein S10, 30S ribosomal protein S11, ... | Authors: | Garaeva, N, Fatkhullin, B, Jenner, L, Soufari, H, Yusupov, M, Usachev, K. | Deposit date: | 2022-10-30 | Release date: | 2023-09-20 | Last modified: | 2023-11-08 | Method: | ELECTRON MICROSCOPY (3.7 Å) | Cite: | Ribosome maturation factor P (RimP) from Staphylococcus aureus Structure, 2023
|
|
1FKA
| STRUCTURE OF FUNCTIONALLY ACTIVATED SMALL RIBOSOMAL SUBUNIT AT 3.3 A RESOLUTION | Descriptor: | 16S RIBOSOMAL RNA, 30S RIBOSOMAL PROTEIN S10, 30S RIBOSOMAL PROTEIN S11, ... | Authors: | Schluenzen, F, Tocilj, A, Zarivach, R, Harms, J, Gluehmann, M, Janell, D, Bashan, A, Bartels, H, Agmon, I, Franceschi, F, Yonath, A. | Deposit date: | 2000-08-09 | Release date: | 2000-09-04 | Last modified: | 2024-02-07 | Method: | X-RAY DIFFRACTION (3.3 Å) | Cite: | Structure of functionally activated small ribosomal subunit at 3.3 angstroms resolution. Cell(Cambridge,Mass.), 102, 2000
|
|
1NJN
| The crystal structure of the 50S Large ribosomal subunit from Deinococcus radiodurans complexed with the antibiotic sparsomycin | Descriptor: | 23S ribosomal RNA, SPARSOMYCIN | Authors: | Bashan, A, Agmon, I, Zarivatch, R, Schluenzen, F, Harms, J.M, Berisio, R, Bartels, H, Hansen, H.A, Yonath, A. | Deposit date: | 2003-01-02 | Release date: | 2003-02-11 | Last modified: | 2023-08-16 | Method: | X-RAY DIFFRACTION (3.7 Å) | Cite: | Structural basis of the ribosomal machinery for Peptide bond formation,
translocation, and nascent chain progression Mol.Cell, 11, 2003
|
|
7KWG
| Staphylococcus aureus 30S ribosomal subunit in presence of spermidine | Descriptor: | 16S ribosomal RNA, 30S ribosomal protein S10, 30S ribosomal protein S11, ... | Authors: | Belinite, M, Khusainov, I, Marzi, S, Romby, P, Yusupov, M, Hashem, Y. | Deposit date: | 2020-11-30 | Release date: | 2021-01-27 | Last modified: | 2024-05-29 | Method: | ELECTRON MICROSCOPY (3.75 Å) | Cite: | Stabilization of Ribosomal RNA of the Small Subunit by Spermidine in Staphylococcus aureus . Front Mol Biosci, 8, 2021
|
|
1NKW
| Crystal Structure Of The Large Ribosomal Subunit From Deinococcus Radiodurans | Descriptor: | 23S ribosomal RNA, 50S ribosomal protein L11, 50S ribosomal protein L13, ... | Authors: | Harms, J.M, Schluenzen, F, Zarivach, R, Bashan, A, Gat, S, Agmon, I, Bartels, H, Franceschi, F, Yonath, A. | Deposit date: | 2003-01-05 | Release date: | 2003-02-11 | Last modified: | 2023-08-16 | Method: | X-RAY DIFFRACTION (3.1 Å) | Cite: | High resolution structure of the large ribosomal subunit from a mesophilic eubacterium Cell(Cambridge,Mass.), 107, 2001
|
|
1C04
| IDENTIFICATION OF KNOWN PROTEIN AND RNA STRUCTURES IN A 5 A MAP OF THE LARGE RIBOSOMAL SUBUNIT FROM HALOARCULA MARISMORTUI | Descriptor: | 23S RRNA FRAGMENT, RIBOSOMAL PROTEIN L11, RIBOSOMAL PROTEIN L14, ... | Authors: | Ban, N, Nissen, P, Capel, M, Moore, P.B, Steitz, T.A. | Deposit date: | 1999-07-14 | Release date: | 1999-08-31 | Last modified: | 2011-07-13 | Method: | X-RAY DIFFRACTION (5 Å) | Cite: | Placement of protein and RNA structures into a 5 A-resolution map of the 50S ribosomal subunit. Nature, 400, 1999
|
|
3BNQ
| |