2Q79
 
 | |
1R36
 | | NMR-based structure of autoinhibited murine Ets-1 deltaN301 | | Descriptor: | C-ets-1 protein | | Authors: | Lee, G.M, Donaldson, L.W, Pufall, M.A, Kang, H.-S, Pot, I, Graves, B.J, McIntosh, L.P. | | Deposit date: | 2003-09-30 | | Release date: | 2004-11-09 | | Last modified: | 2024-05-08 | | Method: | SOLUTION NMR | | Cite: | The Structural and Dynamic Basis of Ets-1 DNA Binding Autoinhibition
J.Biol.Chem., 280, 2005
|
|
6U08
 | |
5XH7
 | | Crystal structure of the Acidaminococcus sp. BV3L6 Cpf1 RR variant in complex with crRNA and target DNA (TCCA PAM) | | Descriptor: | 1,2-ETHANEDIOL, CHLORIDE ION, CRISPR-associated endonuclease Cpf1, ... | | Authors: | Nishimasu, H, Yamano, T, Ishitani, R, Nureki, O. | | Deposit date: | 2017-04-19 | | Release date: | 2017-06-14 | | Last modified: | 2023-11-22 | | Method: | X-RAY DIFFRACTION (2 Å) | | Cite: | Structural Basis for the Altered PAM Recognition by Engineered CRISPR-Cpf1
Mol. Cell, 67, 2017
|
|
8TH9
 | |
6P2G
 | | Structure of HIV-1 Reverse Transcriptase (RT) in complex with dsDNA and D-ddCTP | | Descriptor: | 2',3'-DIDEOXYCYTIDINE 5'-TRIPHOSPHATE, DNA Primer 20-mer, DNA template 27-mer, ... | | Authors: | Bertoletti, N, Anderson, K.S. | | Deposit date: | 2019-05-21 | | Release date: | 2019-07-24 | | Last modified: | 2023-10-11 | | Method: | X-RAY DIFFRACTION (2.99 Å) | | Cite: | Structural insights into the recognition of nucleoside reverse transcriptase inhibitors by HIV-1 reverse transcriptase: First crystal structures with reverse transcriptase and the active triphosphate forms of lamivudine and emtricitabine.
Protein Sci., 28, 2019
|
|
6P1I
 | | Structure of HIV-1 Reverse Transcriptase (RT) in complex with dsDNA and dCTP | | Descriptor: | 2'-DEOXYCYTIDINE-5'-TRIPHOSPHATE, DNA Primer 20-mer, DNA template 27-mer, ... | | Authors: | Bertoletti, N, Anderson, K.S. | | Deposit date: | 2019-05-19 | | Release date: | 2019-07-24 | | Last modified: | 2023-10-11 | | Method: | X-RAY DIFFRACTION (2.74 Å) | | Cite: | Structural insights into the recognition of nucleoside reverse transcriptase inhibitors by HIV-1 reverse transcriptase: First crystal structures with reverse transcriptase and the active triphosphate forms of lamivudine and emtricitabine.
Protein Sci., 28, 2019
|
|
1DU6
 | |
8FCW
 | |
8FF5
 | |
8FTK
 | | Chaetomium thermophilum SETX (Full-length) | | Descriptor: | 5'-3' RNA helicase-like protein | | Authors: | Williams, R.S, Appel, C.D. | | Deposit date: | 2023-01-12 | | Release date: | 2023-10-25 | | Last modified: | 2023-11-01 | | Method: | ELECTRON MICROSCOPY (4.56 Å) | | Cite: | Sen1 architecture: RNA-DNA hybrid resolution, autoregulation, and insights into SETX inactivation in AOA2.
Mol.Cell, 83, 2023
|
|
8Q5O
 | | N-terminal domain of restriction endonuclease Eco15I with tetra-methylated target DNA. | | Descriptor: | CALCIUM ION, DNA (5'-D(*CP*TP*GP*(5CM)P*TP*GP*(5CM)P*TP*C)-3'), DNA (5'-D(*GP*AP*GP*(5CM)P*AP*GP*(5CM)P*AP*G)-3'), ... | | Authors: | Rafalski, D, Krakowska, K, Bochtler, M. | | Deposit date: | 2023-08-09 | | Release date: | 2024-07-17 | | Last modified: | 2024-09-04 | | Method: | X-RAY DIFFRACTION (2.33 Å) | | Cite: | Structural analysis of the BisI family of modification dependent restriction endonucleases.
Nucleic Acids Res., 52, 2024
|
|
5O7H
 | | Structure of the Cascade-I-Fv complex from Shewanella putrefaciens | | Descriptor: | CRISPR-associated protein, Csy4 family, Cas5fv, ... | | Authors: | Pausch, P, Altegoer, F, Bange, G. | | Deposit date: | 2017-06-08 | | Release date: | 2017-08-16 | | Last modified: | 2017-08-30 | | Method: | X-RAY DIFFRACTION (3 Å) | | Cite: | Structural Variation of Type I-F CRISPR RNA Guided DNA Surveillance.
Mol. Cell, 67, 2017
|
|
6G4J
 | |
5XH6
 | | Crystal structure of the Acidaminococcus sp. BV3L6 Cpf1 RVR variant in complex with crRNA and target DNA (TATA PAM) | | Descriptor: | 1,2-ETHANEDIOL, CHLORIDE ION, CRISPR-associated endonuclease Cpf1, ... | | Authors: | Nishimasu, H, Yamano, T, Ishitani, R, Nureki, O. | | Deposit date: | 2017-04-19 | | Release date: | 2017-06-14 | | Last modified: | 2023-11-22 | | Method: | X-RAY DIFFRACTION (2 Å) | | Cite: | Structural Basis for the Altered PAM Recognition by Engineered CRISPR-Cpf1
Mol. Cell, 67, 2017
|
|
6QTP
 | | 2.37A structure of gepotidacin with S.aureus DNA gyrase and uncleaved DNA | | Descriptor: | (3~{R})-3-[[4-(3,4-dihydro-2~{H}-pyrano[2,3-c]pyridin-6-ylmethylamino)piperidin-1-yl]methyl]-1,4,7-triazatricyclo[6.3.1.0^{4,12}]dodeca-6,8(12),9-triene-5,11-dione, DNA (5'-D(*GP*AP*GP*CP*GP*TP*AP*CP*AP*GP*CP*TP*GP*TP*AP*CP*GP*CP*TP*T)-3'), DNA gyrase subunit A, ... | | Authors: | Bax, B.D. | | Deposit date: | 2019-02-25 | | Release date: | 2019-03-13 | | Last modified: | 2024-05-15 | | Method: | X-RAY DIFFRACTION (2.37 Å) | | Cite: | Mechanistic and Structural Basis for the Actions of the Antibacterial Gepotidacin against Staphylococcus aureus Gyrase.
Acs Infect Dis., 5, 2019
|
|
5ITQ
 | | Crystal Structure of Human NEIL1, Free Protein | | Descriptor: | Endonuclease 8-like 1 | | Authors: | Zhu, C, Lu, L, Zhang, J, Yue, Z, Song, J, Zong, S, Liu, M, Stovicek, O, Gao, Y, Yi, C. | | Deposit date: | 2016-03-17 | | Release date: | 2016-07-06 | | Last modified: | 2023-11-08 | | Method: | X-RAY DIFFRACTION (1.48 Å) | | Cite: | Tautomerization-dependent recognition and excision of oxidation damage in base-excision DNA repair
Proc.Natl.Acad.Sci.USA, 113, 2016
|
|
7XI3
 | | Crystal Structure of the NPAS4-ARNT2 heterodimer in complex with DNA | | Descriptor: | Aryl hydrocarbon receptor nuclear translocator 2, DNA (5'-D(P*CP*CP*AP*TP*CP*AP*CP*TP*CP*AP*CP*GP*AP*CP*CP*T)-3'), DNA (5'-D(P*GP*GP*AP*GP*GP*TP*CP*GP*TP*GP*AP*GP*TP*GP*AP*T)-3'), ... | | Authors: | Sun, X.N, Jing, L.Q, Li, F.W, Wu, D.L. | | Deposit date: | 2022-04-11 | | Release date: | 2022-11-02 | | Last modified: | 2023-11-29 | | Method: | X-RAY DIFFRACTION (4.274 Å) | | Cite: | Structures of NPAS4-ARNT and NPAS4-ARNT2 heterodimers reveal new dimerization modalities in the bHLH-PAS transcription factor family.
Proc.Natl.Acad.Sci.USA, 119, 2022
|
|
7XHV
 | | Crystal Structure of the NPAS4-ARNT heterodimer in complex with DNA | | Descriptor: | Aryl hydrocarbon receptor nuclear translocator, DNA (5'-D(P*CP*CP*AP*TP*CP*AP*CP*TP*CP*AP*CP*GP*AP*CP*CP*T)-3'), DNA (5'-D(P*GP*GP*AP*GP*GP*TP*CP*GP*TP*GP*AP*GP*TP*GP*AP*T)-3'), ... | | Authors: | Sun, X.N, Jing, L.Q, Li, F.W, Wu, D.L. | | Deposit date: | 2022-04-10 | | Release date: | 2022-11-02 | | Last modified: | 2023-11-29 | | Method: | X-RAY DIFFRACTION (3.996 Å) | | Cite: | Structures of NPAS4-ARNT and NPAS4-ARNT2 heterodimers reveal new dimerization modalities in the bHLH-PAS transcription factor family.
Proc.Natl.Acad.Sci.USA, 119, 2022
|
|
5VMU
 | | Kaiso (ZBTB33) zinc finger DNA binding domain in complex with a double CpG-methylated DNA resembling the specific Kaiso binding sequence (KBS) | | Descriptor: | CHLORIDE ION, DNA (5'-D(*CP*GP*TP*TP*AP*TP*TP*(5CM)P*GP*(5CM)P*GP*GP*GP*AP*AP*GP*CP*A)-3'), DNA (5'-D(*TP*GP*CP*TP*TP*CP*CP*(5CM)P*GP*(5CM)P*GP*AP*AP*TP*AP*AP*CP*G)-3'), ... | | Authors: | Nikolova, E.N, Stanfield, R.L, Martinez-Yamout, M.A, Dyson, H.J, Wright, P.E. | | Deposit date: | 2017-04-28 | | Release date: | 2018-04-04 | | Last modified: | 2023-10-04 | | Method: | X-RAY DIFFRACTION (2.346 Å) | | Cite: | CH···O Hydrogen Bonds Mediate Highly Specific Recognition of Methylated CpG Sites by the Zinc Finger Protein Kaiso.
Biochemistry, 57, 2018
|
|
5VMZ
 | | Kaiso (ZBTB33) E535Q mutant zinc finger DNA binding domain in complex with a double CpG-methylated DNA resembling the specific Kaiso binding sequence (KBS) | | Descriptor: | CHLORIDE ION, DNA (5'-D(*CP*GP*TP*TP*AP*TP*TP*(5CM)P*GP*(5CM)P*GP*GP*GP*AP*AP*GP*CP*A)-3'), DNA (5'-D(*TP*GP*CP*TP*TP*CP*CP*(5CM)P*GP*(5CM)P*GP*AP*AP*TP*AP*AP*CP*G)-3'), ... | | Authors: | Nikolova, E.N, Stanfield, R.L, Martinez-Yamout, M.A, Dyson, H.J, Wright, P.E. | | Deposit date: | 2017-04-28 | | Release date: | 2018-04-04 | | Last modified: | 2023-10-04 | | Method: | X-RAY DIFFRACTION (2.319 Å) | | Cite: | CH···O Hydrogen Bonds Mediate Highly Specific Recognition of Methylated CpG Sites by the Zinc Finger Protein Kaiso.
Biochemistry, 57, 2018
|
|
5VMX
 | | Kaiso (ZBTB33) zinc finger DNA binding domain in complex with a hemi CpG-methylated DNA resembling the specific Kaiso binding sequence (KBS) | | Descriptor: | CHLORIDE ION, DNA (5'-D(*CP*GP*TP*TP*AP*TP*TP*CP*GP*CP*GP*GP*GP*AP*AP*GP*CP*A)-3'), DNA (5'-D(*TP*GP*CP*TP*TP*CP*CP*(5CM)P*GP*(5CM)P*GP*AP*AP*TP*AP*AP*CP*G)-3'), ... | | Authors: | Nikolova, E.N, Stanfield, R.L, Martinez-Yamout, M.A, Dyson, H.J, Wright, P.E. | | Deposit date: | 2017-04-28 | | Release date: | 2018-04-04 | | Last modified: | 2023-10-04 | | Method: | X-RAY DIFFRACTION (2.05 Å) | | Cite: | CH···O Hydrogen Bonds Mediate Highly Specific Recognition of Methylated CpG Sites by the Zinc Finger Protein Kaiso.
Biochemistry, 57, 2018
|
|
5VMY
 | | Kaiso (ZBTB33) zinc finger DNA binding domain in complex with a hemi CpG-methylated DNA resembling the specific Kaiso binding sequence (KBS) | | Descriptor: | CHLORIDE ION, DNA (5'-D(*CP*GP*TP*TP*AP*TP*TP*CP*GP*CP*GP*GP*GP*AP*AP*GP*CP*A)-3'), DNA (5'-D(*TP*GP*CP*TP*TP*CP*CP*(5CM)P*GP*(5CM)P*GP*AP*AP*TP*AP*AP*CP*G)-3'), ... | | Authors: | Nikolova, E.N, Stanfield, R.L, Martinez-Yamout, M.A, Dyson, H.J, Wright, P.E. | | Deposit date: | 2017-04-28 | | Release date: | 2018-04-04 | | Last modified: | 2023-10-04 | | Method: | X-RAY DIFFRACTION (2.002 Å) | | Cite: | CH···O Hydrogen Bonds Mediate Highly Specific Recognition of Methylated CpG Sites by the Zinc Finger Protein Kaiso.
Biochemistry, 57, 2018
|
|
1KX5
 | | X-Ray Structure of the Nucleosome Core Particle, NCP147, at 1.9 A Resolution | | Descriptor: | CHLORIDE ION, DNA (5'(ATCAATATCCACCTGCAGATACTACCAAAAGTGTATTTGGAAACTGCTCCATCAAAAGGCATGTTCAGCTGGAATCCAGCTGAACATGCCTTTTGATGGAGCAGTTTCCAAATACACTTTTGGTAGTATCTGCAGGTGGATATTGAT)3'), DNA (5'(ATCAATATCCACCTGCAGATACTACCAAAAGTGTATTTGGAAACTGCTCCATCAAAAGGCATGTTCAGCTGGATTCCAGCTGAACATGCCTTTTGATGGAGCAGTTTCCAAATACACTTTTGGTAGTATCTGCAGGTGGATATTGAT)3'), ... | | Authors: | Davey, C.A, Sargent, D.F, Luger, K, Maeder, A.W, Richmond, T.J. | | Deposit date: | 2002-01-31 | | Release date: | 2002-12-25 | | Last modified: | 2023-08-16 | | Method: | X-RAY DIFFRACTION (1.94 Å) | | Cite: | Solvent Mediated Interactions in the Structure of the Nucleosome Core Particle at 1.9 A Resolution
J.Mol.Biol., 319, 2002
|
|
4C3G
 | | cryo-EM structure of activated and oligomeric restriction endonuclease SgrAI | | Descriptor: | 5'-D(*CP*CP*GP*GP*TP*GP*TP*GP*AP*AP*GP*AP*CP*CP *CP*AP*CP*GP*CP*AP*TP*CP)-3', 5'-D(*GP*AP*TP*GP*CP*GP*TP*GP*GP*GP*TP*CP*TP*TP *CP*AP*CP*AP)-3', SGRAIR RESTRICTION ENZYME | | Authors: | Lyumkis, D, Talley, H, Stewart, A, Shah, S, Park, C.K, Tama, F, Potter, C.S, Carragher, B, Horton, N.C. | | Deposit date: | 2013-08-23 | | Release date: | 2013-09-11 | | Last modified: | 2024-05-08 | | Method: | ELECTRON MICROSCOPY (8.6 Å) | | Cite: | Allosteric Regulation of DNA Cleavage and Sequence-Specificity Through Run-on Oligomerization.
Structure, 21, 2013
|
|
